Feature Extraction
Transformers
PyTorch
Safetensors
English
bert
token-classification
text-embeddings-inference
Instructions to use bioscan-ml/BarcodeBERT with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- Transformers
How to use bioscan-ml/BarcodeBERT with Transformers:
# Use a pipeline as a high-level helper from transformers import pipeline pipe = pipeline("feature-extraction", model="bioscan-ml/BarcodeBERT")# Load model directly from transformers import AutoTokenizer, AutoModelForTokenClassification tokenizer = AutoTokenizer.from_pretrained("bioscan-ml/BarcodeBERT") model = AutoModelForTokenClassification.from_pretrained("bioscan-ml/BarcodeBERT", device_map="auto") - Notebooks
- Google Colab
- Kaggle
File size: 1,899 Bytes
2fa1eca 7d23648 d635521 2fa1eca 7d23648 2fa1eca 2c0808a ce0a983 2fa1eca a8650f6 2fa1eca 4025bf2 2fa1eca 4025bf2 a8650f6 2fa1eca 4025bf2 2fa1eca 4025bf2 2fa1eca 4025bf2 2fa1eca 7d23648 | 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 | ---
language:
- en
license: mit
pipeline_tag: feature-extraction
library_name: transformers
description: "Pretrained weights for BarcodeBERT, a transformer for insect DNA barcode inference."
---
# BarcodeBERT for Taxonomic Classification
A pre-trained transformer model for inference on insect DNA barcoding data, as presented in the paper [BarcodeBERT: Transformers for Biodiversity Analysis](https://huggingface.co/papers/2311.02401).
Code: https://github.com/bioscan-ml/BarcodeBERT
[Colab](https://colab.research.google.com/drive/1MUEQVHIOX2ks7tLsMoQtNlbvsbSuYgs1)
To use **BarcodeBERT** as a feature extractor:
```python
from transformers import AutoTokenizer, BertForTokenClassification
# Load the tokenizer
tokenizer = AutoTokenizer.from_pretrained(
"bioscan-ml/BarcodeBERT", trust_remote_code=True
)
# Load the model
model = BertForTokenClassification.from_pretrained("bioscan-ml/BarcodeBERT", trust_remote_code=True)
# Sample sequence
dna_seq = "ACGCGCTGACGCATCAGCATACGA"
# Tokenize
input_seq = tokenizer(dna_seq, return_tensors="pt")["input_ids"]
# Pass through the model
output = model(input_seq.unsqueeze(0))["hidden_states"][-1]
# Compute Global Average Pooling
features = output.mean(1)
```
## Citation
If you find BarcodeBERT useful in your research please consider citing:
@misc{arias2023barcodebert,
title={{BarcodeBERT}: Transformers for Biodiversity Analysis},
author={Pablo Millan Arias
and Niousha Sadjadi
and Monireh Safari
and ZeMing Gong
and Austin T. Wang
and Scott C. Lowe
and Joakim Bruslund Haurum
and Iuliia Zarubiieva
and Dirk Steinke
and Lila Kari
and Angel X. Chang
and Graham W. Taylor
},
year={2023},
eprint={2311.02401},
archivePrefix={arXiv},
primaryClass={cs.LG},
doi={10.48550/arxiv.2311.02401},
} |