diff --git "a/offline_results/exp_ga.csv" "b/offline_results/exp_ga.csv"
--- "a/offline_results/exp_ga.csv"
+++ "b/offline_results/exp_ga.csv"
@@ -40,7 +40,7 @@ Blood Gas Analysis
 To exclude severe hypoxia, hypercapnia or lactic acidosis, a blood gas analysis was performed for example in one animal of each group by transcutaneous puncture of the left ventricle. The probe was analyzed by a blood gas analyzer (Radiometer ABL series, Radiometer, Copenhagen, Denmark).
 
 Statistical Analysis
-The Kolmogorov Smirnov test was used to test for normal distribution. The results of the sum scores were compared using the Mann–Whitney U test between controls and propofol as well as between controls and sevoflurane. The place version data of the water maze test were analyzed by two-way ANOVAs on repeated measures followed by Holm-Sidak method for post-hoc multiple pair-wise comparisons. The spatial probe and the cued version data were analyzed by one-way ANOVAs followed by Holm-Sidak post-hoc tests. The data of the hole board test were analyzed by paired t-tests. Differences were considered to be significant if P < 0.05.",rats,"['Wistar rat pups were purchased from the Bundesinstitut für gesundheitlichen Verbraucherschutz und Veterinärmedizin BgVV, Berlin, Germany.']",postnatal day 6,['Six-day-old Wistar rats received either intraperitoneal (i.p.) injections of propofol or underwent inhalational anesthesia with sevoflurane and were separated from their mother during the experimental phase.'],Y,"['For behavioral testing n = 13 propofol treated, n = 7 sevoflurane treated animals and n = 6 controls were anesthetized as described above.', 'Morris Water Maze (MWM) Test', 'Hole Board Test']",propofol,['For propofol anesthesia doses of 30 mg/kg body weight were given every 90 min up to a cumulative dose of 90 mg/kg.'],sevoflurane,"['For gas administration rats were placed into an incubation chamber (Billups Rothenberg Inc., Del Mar, USA), which was connected to an anesthesia system (F.Stephan GmBH, Gackenbach) for 6 h.', 'Carbon dioxide and sevoflurane concentrations were monitored using a gas monitor (Datex Ohmeda, GE Healthcare, Munich, Germany).']",wistar,"['Wistar rat pups were purchased from the Bundesinstitut für gesundheitlichen Verbraucherschutz und Veterinärmedizin BgVV, Berlin, Germany.']",True,True,True,True,True,True,10.1007/s12640-009-9063-8
+The Kolmogorov Smirnov test was used to test for normal distribution. The results of the sum scores were compared using the Mann–Whitney U test between controls and propofol as well as between controls and sevoflurane. The place version data of the water maze test were analyzed by two-way ANOVAs on repeated measures followed by Holm-Sidak method for post-hoc multiple pair-wise comparisons. The spatial probe and the cued version data were analyzed by one-way ANOVAs followed by Holm-Sidak post-hoc tests. The data of the hole board test were analyzed by paired t-tests. Differences were considered to be significant if P < 0.05.",rats,"['Wistar rat pups were purchased from the Bundesinstitut für gesundheitlichen Verbraucherschutz und Veterinärmedizin BgVV, Berlin, Germany.']",postnatal day 6,['Six-day-old Wistar rats received either intraperitoneal (i.p.) injections of propofol or underwent inhalational anesthesia with sevoflurane and were separated from their mother during the experimental phase.'],Y,"['For behavioral testing n = 13 propofol treated, n = 7 sevoflurane treated animals and n = 6 controls were anesthetized as described above.', 'Morris Water Maze (MWM) Test', 'Hole Board Test']",propofol,['For propofol anesthesia doses of 30 mg/kg body weight were given every 90 min up to a cumulative dose of 90 mg/kg.'],sevoflurane,"['For gas administration rats were placed into an incubation chamber (Billups Rothenberg Inc., Del Mar, USA), which was connected to an anesthesia system (F.Stephan GmBH, Gackenbach) for 6 h.', 'Carbon dioxide and sevoflurane concentrations were monitored using a gas monitor (Datex Ohmeda, GE Healthcare, Munich, Germany).']",wistar,"['Wistar rat pups were purchased from the Bundesinstitut für gesundheitlichen Verbraucherschutz und Veterinärmedizin BgVV, Berlin, Germany.']",True,True,True,True,True,True,[ Passage 1/25 ] 10.1007/s12640-009-9063-8
 10.1002/cbin.10349,4738.0,Cao,2015,mice,postnatal day 14,Y,ketamine,none,c57bl/6,"PMID: 25052764 DOI: 10.1002/cbin.10349
 Materials and methods
 Animals
@@ -71,7 +71,7 @@ Morris water maze (MWM) testing
 The MWM testing was carried out 1 month after hippocampal transfection of miR-34c knockdown. Eight mice with Lenti-miR34c-I injection and 5 mice with Lenti-miR34c-C injection were included in this analysis. In a large circular tank with a transparent platform (10 cm × 10 cm), warm water at 26°C was added to submerge the platform 1 cm below the surface. Visual cues of color paints were used to aid mice in locating the platform. The mice were given training sessions four times per day for one week before final testing. In each training session, the mice were put in the maze to locate the platform in 2 min followed by resting on the platform for 30 s. If mice did not locate the platform in 2 min, they were aided with flashing lights to the platform with 30 s of rest on top of the platform. On the final day of examination, the average swimming time and swimming distance were compared between control mice and the mice with miR-34c knockdown.
 
 Statistical analysis
-Statistic analysis was conducted with SPSS software (version 11.0). The measured data were presented as mean ± standard deviations. The statistical differences were measured with a Student's t-test, and the significance set at P < 0.05.",mice,"['C57BL/6 mice were purchased from Shanghai Laboratory Animal Center, Chinese Academy of Sciences (Shanghai, China).']",postnatal day 14,"['Young C57BL/6 mice, postnatal 14 days, were intraperitoneally administrated with repeated dosage of 75\u2009mg/kg ketamine per day for six consecutive days (n\u2009=\u200928).']",Y,['The MWM testing was carried out 1 month after hippocampal transfection of miR-34c knockdown.'],ketamine,"['Young C57BL/6 mice, postnatal 14 days, were intraperitoneally administrated with repeated dosage of 75\u2009mg/kg ketamine per day for six consecutive days (n\u2009=\u200928).']",none,[],c57bl/6,"['C57BL/6 mice were purchased from Shanghai Laboratory Animal Center, Chinese Academy of Sciences (Shanghai, China).']",True,True,True,True,True,True,10.1002/cbin.10349
+Statistic analysis was conducted with SPSS software (version 11.0). The measured data were presented as mean ± standard deviations. The statistical differences were measured with a Student's t-test, and the significance set at P < 0.05.",mice,"['C57BL/6 mice were purchased from Shanghai Laboratory Animal Center, Chinese Academy of Sciences (Shanghai, China).']",postnatal day 14,"['Young C57BL/6 mice, postnatal 14 days, were intraperitoneally administrated with repeated dosage of 75\u2009mg/kg ketamine per day for six consecutive days (n\u2009=\u200928).']",Y,['The MWM testing was carried out 1 month after hippocampal transfection of miR-34c knockdown.'],ketamine,"['Young C57BL/6 mice, postnatal 14 days, were intraperitoneally administrated with repeated dosage of 75\u2009mg/kg ketamine per day for six consecutive days (n\u2009=\u200928).']",none,[],c57bl/6,"['C57BL/6 mice were purchased from Shanghai Laboratory Animal Center, Chinese Academy of Sciences (Shanghai, China).']",True,True,True,True,True,True,[ Passage 2/25 ] 10.1002/cbin.10349
 10.1213/ANE.0000000000000030,903.0,Cheng,2014,mice,postnatal day 7,N,isoflurane,none,cd-1,"PMID: 24413549 PMCID: PMC4029883 DOI: 10.1213/ANE.0000000000000030
 METHODS
 Animal Exposures
@@ -95,7 +95,7 @@ Immediately after 1-hour exposure, forebrain mitochondria and cytosol were isola
 Mitochondrial and cytosolic heme c content were calculated from the difference in spectra (dithionate/ascorbate reduced minus air-oxidized) of mitochondria or cytosolic protein (0.5–1 mg) solubilized in 10% lauryl maltoside using an absorption coefficient of 20.5 mM−1 cm−1 at 550 to 535 nm.32,33 Five animals per cohort were evaluated.
 
 Statistical Analysis
-Sample sizes for each end point were chosen based on previous work.19 Our previous study used 8 animals per cohort for COHb and heme c determination, 3 to 4 animals per cohort for activated caspase-3 and TUNEL assessment, and 5 animals per cohort for measurement of cytochrome c peroxidase activity, and data followed normal probability distribution.19 For this work, sample sizes were based on the number of animals needed to detect a 30% difference from air-exposed control values with a power of 80 based on an α of 0.01. Data are presented as mean ± SE. To assess statistical significance, we performed pairwise comparisons in an analysis of variance design using Tukey test.",mice,"['Six- to 8-week-old CD-1 pregnant female mice (20–30 grams) were acquired (Charles River, Wilmington, MA) to yield newborn pups.']",postnatal day 7,"['On postnatal day 7 (P7), we exposed male CD-1 mouse pups to 0 ppm CO (air), 5 ppm CO in air, or 100 ppm CO in air with and without isoflurane (2%) for 1 hour in a 7-L Plexiglas chamber (25 × 20 × 14 cm).']",N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",isoflurane,"['On postnatal day 7 (P7), we exposed male CD-1 mouse pups to 0 ppm CO (air), 5 ppm CO in air, or 100 ppm CO in air with and without isoflurane (2%) for 1 hour in a 7-L Plexiglas chamber (25 × 20 × 14 cm).']",none,[],cd-1,"['Six- to 8-week-old CD-1 pregnant female mice (20–30 grams) were acquired (Charles River, Wilmington, MA) to yield newborn pups.']",True,True,True,True,True,True,10.1213/ANE.0000000000000030
+Sample sizes for each end point were chosen based on previous work.19 Our previous study used 8 animals per cohort for COHb and heme c determination, 3 to 4 animals per cohort for activated caspase-3 and TUNEL assessment, and 5 animals per cohort for measurement of cytochrome c peroxidase activity, and data followed normal probability distribution.19 For this work, sample sizes were based on the number of animals needed to detect a 30% difference from air-exposed control values with a power of 80 based on an α of 0.01. Data are presented as mean ± SE. To assess statistical significance, we performed pairwise comparisons in an analysis of variance design using Tukey test.",mice,"['Six- to 8-week-old CD-1 pregnant female mice (20–30 grams) were acquired (Charles River, Wilmington, MA) to yield newborn pups.']",postnatal day 7,"['On postnatal day 7 (P7), we exposed male CD-1 mouse pups to 0 ppm CO (air), 5 ppm CO in air, or 100 ppm CO in air with and without isoflurane (2%) for 1 hour in a 7-L Plexiglas chamber (25 × 20 × 14 cm).']",N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",isoflurane,"['On postnatal day 7 (P7), we exposed male CD-1 mouse pups to 0 ppm CO (air), 5 ppm CO in air, or 100 ppm CO in air with and without isoflurane (2%) for 1 hour in a 7-L Plexiglas chamber (25 × 20 × 14 cm).']",none,[],cd-1,"['Six- to 8-week-old CD-1 pregnant female mice (20–30 grams) were acquired (Charles River, Wilmington, MA) to yield newborn pups.']",True,True,True,True,True,True,[ Passage 3/25 ] 10.1213/ANE.0000000000000030
 10.1007/s12640-018-9877-3,437.0,Chen,2018,rats,postnatal day 7,Y,sevoflurane,none,sprague dawley,"PMID: 29427282 DOI: 10.1007/s12640-018-9877-3
 Methods
 Ethical Approval
@@ -122,7 +122,7 @@ Transmission Electron Microscopy
 TEM was used to assess synaptic plasticity in the hippocampus after exposure to treatment (n = 5 in each group) at P35. Twenty-eight days after exposure to treatment, the rats were perfused transcardially with 50 mL of 0.9% normal saline, followed by 50 mL of a mixture of 2% paraformaldehyde and 2.5% glutaraldehyde (Sigma-Aldrich, G6257, USA) in 0.1 M PBS. Approximately 1 mm3 of tissue per rat was dissected from the hippocampus and fixed in 2% glutaraldehyde for 2 h at 4 °C. The tissues were rinsed in 0.1 M cacodylate buffer and postfixed with 1% osmium tetroxide for 2 h. Then, the tissue was rinsed with distilled water before undergoing dehydration in a graded ethanol series. Subsequently, the tissue was infiltrated overnight at 4 °C using a mixture of half acetone and half resin. The tissue was embedded in resin 24 h later and then cured fully as follows: 37 °C overnight, 45 °C for 12 h, and 60 °C for 24 h. After that, 70-nm sections were cut and stained with 3% uranyl acetate for 20 min and 0.5% lead citrate for 5 min. Ultrastructural changes in synapses in the hippocampus were observed under TEM. Five pictures of each subregion per ultrathin section (five rats in total per group) were taken at each of two magnifications: × 13,500 and × 37,000. All pictures taken at × 13,500 magnification were used to observe the number of synapses, and all pictures taken at × 37,000 magnification were used to measure the thickness of the postsynaptic density and the width of the synaptic cleft. The number of synapses was expressed as the average number of synapses in each picture taken at × 13,500. The thickness of the postsynaptic density and the width of the synaptic were expressed as the average values for all synapses in all pictures taken at × 37,000, as described. We measured the distances using the image analysis software ImageJ.
 
 Statistical Analysis
-The results were expressed as the mean ± standard deviation (SD) for each group. The statistical tests were conducted using the computerized statistical package SPSS 19.0 (SPSS Inc., Chicago, IL, USA) and GraphPad Prism Software version 5.0 (GraphPad Software, Inc., San Diego, CA, USA). The arterial blood data were analyzed using Student’s t test. One-way ANOVA was used to evaluate differences in the quantities of hippocampal proteins, numbers of BrdU-positive cells and synapses, and ultrastructure parameters of synapses among groups. Unpaired t tests and two-way ANOVA were used to analyze the results of the MWM. Each experiment was performed at least three times. A value of P < 0.05 was considered statistically significant.",rats,"['The use of rats in this study was approved by the Institutional Animal Care and Use Committee at Sun Yat-sen University (Guangzhou, China).']",postnatal day 7,"['SD rats at P7 (weight 14–16 g) were randomly divided into the air-treated control (C group), the 1.2% sevoflurane-exposed (1.2% sevo group), and the 2.4% sevoflurane-exposed (2.4% sevo group).']",Y,"['On P35, the rats were tested for spatial learning and memory ability using the Morris water maze (MWM).']",sevoflurane,"['the 1.2% sevoflurane-exposed (1.2% sevo group), and the 2.4% sevoflurane-exposed (2.4% sevo group).']",none,[],sprague dawley,"['Sprague-Dawley multiparous dams (n =\u200931) with litters containing male pups (n =\u2009135) were purchased from Experimental Animal Center of Sun Yat-sen University, China.']",True,True,True,True,True,True,10.1007/s12640-018-9877-3
+The results were expressed as the mean ± standard deviation (SD) for each group. The statistical tests were conducted using the computerized statistical package SPSS 19.0 (SPSS Inc., Chicago, IL, USA) and GraphPad Prism Software version 5.0 (GraphPad Software, Inc., San Diego, CA, USA). The arterial blood data were analyzed using Student’s t test. One-way ANOVA was used to evaluate differences in the quantities of hippocampal proteins, numbers of BrdU-positive cells and synapses, and ultrastructure parameters of synapses among groups. Unpaired t tests and two-way ANOVA were used to analyze the results of the MWM. Each experiment was performed at least three times. A value of P < 0.05 was considered statistically significant.",rats,"['The use of rats in this study was approved by the Institutional Animal Care and Use Committee at Sun Yat-sen University (Guangzhou, China).']",postnatal day 7,"['SD rats at P7 (weight 14–16 g) were randomly divided into the air-treated control (C group), the 1.2% sevoflurane-exposed (1.2% sevo group), and the 2.4% sevoflurane-exposed (2.4% sevo group).']",Y,"['On P35, the rats were tested for spatial learning and memory ability using the Morris water maze (MWM).']",sevoflurane,"['the 1.2% sevoflurane-exposed (1.2% sevo group), and the 2.4% sevoflurane-exposed (2.4% sevo group).']",none,[],sprague dawley,"['Sprague-Dawley multiparous dams (n =\u200931) with litters containing male pups (n =\u2009135) were purchased from Experimental Animal Center of Sun Yat-sen University, China.']",True,True,True,True,True,True,[ Passage 4/25 ] 10.1007/s12640-018-9877-3
 10.1021/acschemneuro.0c00106,3879.0,Chen,2020,mice,postnatal day 7,Y,sevoflurane,none,c57bl/6,"PMID: 32271540 DOI: 10.1021/acschemneuro.0c00106
 Materials and Methods
 ARTICLE SECTIONSJump To
@@ -147,7 +147,7 @@ Frozen hippocampus homogenates were lysed using radioimmunoprecipitation buffer
 cAMP Concentration Assay
 cAMP levels were measured using the mouse cAMP ELISA kit (ab133051, Biocompare, South San Francisco, CA) following the manufacturer’s instructions.
 Statistical Analysis
-Statistical analyses were carried out by using the SPSS 11.0 package. Differences between groups were analyzed using analysis of variance (ANOVA) or two-sample t test with Bonferroni correction. All data represent mean ± standard deviation (SD). Statistical significance thresholds were set at *P < 0.05.",mice,"['Seven day old C57BL/6 male mice (Beijing Vital River Company, Beijing, China) were used in this study.']",postnatal day 7,"['Seven day old C57BL/6 male mice (Beijing Vital River Company, Beijing, China) were used in this study.']",Y,['The spatial memory ability of control and treated mice was determined using the Morris water maze test developed by Richard Morris.'],sevoflurane,"['Thirty minutes later, the injected pups were put into a semiclosed chamber and exposed to 3% sevoflurane for 4 h.']",none,[],c57bl/6,"['Seven day old C57BL/6 male mice (Beijing Vital River Company, Beijing, China) were used in this study.']",True,True,True,True,True,True,10.1021/acschemneuro.0c00106
+Statistical analyses were carried out by using the SPSS 11.0 package. Differences between groups were analyzed using analysis of variance (ANOVA) or two-sample t test with Bonferroni correction. All data represent mean ± standard deviation (SD). Statistical significance thresholds were set at *P < 0.05.",mice,"['Seven day old C57BL/6 male mice (Beijing Vital River Company, Beijing, China) were used in this study.']",postnatal day 7,"['Seven day old C57BL/6 male mice (Beijing Vital River Company, Beijing, China) were used in this study.']",Y,['The spatial memory ability of control and treated mice was determined using the Morris water maze test developed by Richard Morris.'],sevoflurane,"['Thirty minutes later, the injected pups were put into a semiclosed chamber and exposed to 3% sevoflurane for 4 h.']",none,[],c57bl/6,"['Seven day old C57BL/6 male mice (Beijing Vital River Company, Beijing, China) were used in this study.']",True,True,True,True,True,True,[ Passage 5/25 ] 10.1021/acschemneuro.0c00106
 10.1016/j.ijdevneu.2019.04.002,248.0,Goyagi,2019,rats,postnatal day 7,Y,sevoflurane,none,wistar,"PMID: 30959098 DOI: 10.1016/j.ijdevneu.2019.04.002
 2 Material and methods
 All animal protocols were approved by the animal research committee of Akita University, Japan (Approval number: a-1-2625). Seven-day-old (P7) Wistar rats (male and female) rat pups (body weight, 12–15 g) were used in this study. Animals were housed under standard conditions (12 h light/12 h dark cycle at 22 °C) in the Animal Research Laboratory at Akita University. All efforts to reduce the number of animals and their suffering were made. The animals were randomly divided into 6 groups (n = 10 per group) as follows: no anesthesia and no injection (sham), no anesthesia and intraperitoneal 25 μg/kg DEX (control), intraperitoneal saline (DEX 0), intraperitoneal 6.6 μg/kg DEX (DEX 6.6), intraperitoneal 12.5 μg/kg DEX (DEX 12.5), and intraperitoneal 25 μg/kg DEX (DEX 25).
@@ -169,7 +169,7 @@ After finished the water maze task and fear conditioning test at P49, the rats
 The PCDM was made as described previously (Goyagi, 2018; Wada et al., 2006). In brief, the composite image was FFT- bandpass-filtered using the Image J program (National Institute of Health, Bethesda, MD) to eliminate low-frequency drifts (>20 pixels [50 μm]) and high-frequency noises (<1 pixel [2.5 μm]). The PDCM was made with a custom-made program using MATLAB (MathWorks INC., Natick, MA) (Wada et al., 2006), then adjusted for each section automatically and enumeration of NeuN-positive cells in each 100 μm × 100 μm square section. Finally, the normalized PCDMs were seen as averaged for each group (Fig. 6 A). As mentioned our previous study (Goyagi, 2018), the PCDMs were analyzed whether the DEX-treated groups showed increased NeuN cell density compared with the DEX 0 group. The areas were mapped as colored to indicate significantly increased normal neurons in blocks where the P value was less than 0.05 (Fig. 6B).
 
 Statistical analysis
-The escape latency, the swimming speed, the swimming path length, the freezing time, and the number of NeuN-positive cells are expressed as means ± standard deviation (SD). Comparisons of these variables among the groups were performed using a one-way or two-way analysis of variance (ANOVA) for multiple comparisons followed by Bonferroni post hoc tests. Each PCDM using a Gaussian filter of the block size (SD = 100 μm) was analyzed using t-tests for each block. Differences with p-values less than 0.05 were considered statistically significant. We performed all analyses using GraphPad Prism 6 (GraphPad Software, Inc., San Diego, CA).",rats,"['Seven-day-old (P7) Wistar rats (male and female) rat pups (body weight, 12–15\u2009g) were used in this study.']",postnatal day 7,"['Seven-day-old (P7) Wistar rats (male and female) rat pups (body weight, 12–15\u2009g) were used in this study.']",Y,"['Spatial memory retention was examined using the Morris water maze by blinded observer as described previously (Goyagi, 2018).', 'Fear conditioning was performed to evaluate contextual memory retention using the fear conditioning system (MK-450RSQ; Muromachi Kikai Co., Ltd, Tokyo, Japan) as described previously (Goyagi, 2018).']",sevoflurane,"['the pups were put into a plastic chamber, exposed to 3% sevoflurane with 2\u2009L/min of 21% oxygen for 4\u2009h']",none,[],wistar,"['Seven-day-old (P7) Wistar rats (male and female) rat pups (body weight, 12–15\u2009g) were used in this study.']",True,True,True,True,True,True,10.1016/j.ijdevneu.2019.04.002
+The escape latency, the swimming speed, the swimming path length, the freezing time, and the number of NeuN-positive cells are expressed as means ± standard deviation (SD). Comparisons of these variables among the groups were performed using a one-way or two-way analysis of variance (ANOVA) for multiple comparisons followed by Bonferroni post hoc tests. Each PCDM using a Gaussian filter of the block size (SD = 100 μm) was analyzed using t-tests for each block. Differences with p-values less than 0.05 were considered statistically significant. We performed all analyses using GraphPad Prism 6 (GraphPad Software, Inc., San Diego, CA).",rats,"['Seven-day-old (P7) Wistar rats (male and female) rat pups (body weight, 12–15\u2009g) were used in this study.']",postnatal day 7,"['Seven-day-old (P7) Wistar rats (male and female) rat pups (body weight, 12–15\u2009g) were used in this study.']",Y,"['Spatial memory retention was examined using the Morris water maze by blinded observer as described previously (Goyagi, 2018).', 'Fear conditioning was performed to evaluate contextual memory retention using the fear conditioning system (MK-450RSQ; Muromachi Kikai Co., Ltd, Tokyo, Japan) as described previously (Goyagi, 2018).']",sevoflurane,"['the pups were put into a plastic chamber, exposed to 3% sevoflurane with 2\u2009L/min of 21% oxygen for 4\u2009h']",none,[],wistar,"['Seven-day-old (P7) Wistar rats (male and female) rat pups (body weight, 12–15\u2009g) were used in this study.']",True,True,True,True,True,True,[ Passage 6/25 ] 10.1016/j.ijdevneu.2019.04.002
 10.1097/EJA.0b013e328330d453,667.0,Han,2010,rats,postnatal day 7,N,ketamine,none,sprague dawley,"PMID: 19918184 DOI: 10.1097/EJA.0b013e328330d453
 Materials and methods
 Animals
@@ -184,7 +184,7 @@ Quantitative PCR was set up using SYBR Green-containing premix from Takara. The
 
 Immunohistochemistry
 Rats in the control group and those in the K1 and K3 subgroups (n = 4), which were sacrificed on PND 7 or PND 28, were perfused transcardially with 100 ml of 0.01 mol l−1 PBS (pH 7.4), followed by 100 ml of 4% (w/v) paraformaldehyde and 75% (v/v) saturated picric acid in 0.1 mol l−1 phosphate buffer (pH 7.4). The brains were then removed immediately and placed into the same fresh fixative for an additional 2 h at 4°C. Subsequently, the brains were placed into 30% (w/v) sucrose solution in 0.1 mol l−1 phosphate buffer (pH 7.4) overnight at 4°C (the sucrose solution contained 0.02% NaN3), and then cut serially into 30 μm thick coronal sections by the use of a freezing microtome (Kryostat 1720; Leitz, Mannheim, Germany). The sections were placed into five different dishes according to their numerical order while cutting (e.g. sections 1 and 7 in dish 1; sections 2 and 8 in dish 2; sections 3 and 9 in dish 3; sections 4 and 10 in dish 4; and sections 5 and 11 in dish 5). Each dish usually contained 28–32 sections. All sections were washed carefully with 0.01 mol l−1 PBS. The sections in the first three dishes were used for immunohistochemistry for NR2A–2C. Briefly, the sections were incubated at 4°C sequentially with: a mixture of rabbit anti-NR2A, 2B and 2C serum (1: 200 dilution; Elek molnar) for 24 h; biotinylated goat antirabbit immunoglobulin G (1: 200 dilution; Vector) for 2 h; and avidin-labelled horseradish peroxidase compound (1: 100 dilution; Vector) for 1 h. The diluent used for all antibodies was 0.05 mol l−1 PBS containing 5% (v/v) normal donkey serum, 0.5% (v/v) Triton X-100, 0.05% (w/v) sodium azide (NaN3) and 0.25% (w/v) carrageenan (pH 7.3). In the fourth dish, normal rabbit serum was used instead of rabbit anti-NR2A, 2B and 2C serum, and the following steps were the same as mentioned above. The fifth dish was used for Nissl staining in order to locate a positive construction. The sections were rinsed at least three times in 0.01 mol l−1 PBS (pH 7.4) after each incubation, for at least 10 min. The sections were coloured with diaminobenzidine (DAB) and H2O2, then sections were mounted onto clean glass slides, air dried and cover-slipped with a mixture of 50% (v/v) glycerin and 2.5% (w/v) triethylene diamine (antifading agent) in 0.01 mol l−1 PBS. Finally, the sections were studied under a microscope.
-",rats,['Seven-day-old male and female Sprague Dawley rats (body weight 11.1–17.5 g) were housed in plastic cages with their mothers and maintained on a 12: 12 h light/dark cycle at 22–25°C ambient temperature with food and water available ad libitum for the mothers.'],postnatal day 7,['Rats (n = 40) were divided into two random groups. In one group (n = 20) the rats were injected with ketamine intraperitoneally (i.p.) at PND 7 [8] and sacrificed within 24 h.'],N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",ketamine,['In one group (n = 20) the rats were injected with ketamine intraperitoneally (i.p.) at PND 7 [8] and sacrificed within 24 h.'],none,[],sprague dawley,['Seven-day-old male and female Sprague Dawley rats (body weight 11.1–17.5 g) were housed in plastic cages with their mothers and maintained on a 12: 12 h light/dark cycle at 22–25°C ambient temperature with food and water available ad libitum for the mothers.'],True,True,True,True,True,True,10.1097/EJA.0b013e328330d453
+",rats,['Seven-day-old male and female Sprague Dawley rats (body weight 11.1–17.5 g) were housed in plastic cages with their mothers and maintained on a 12: 12 h light/dark cycle at 22–25°C ambient temperature with food and water available ad libitum for the mothers.'],postnatal day 7,['Rats (n = 40) were divided into two random groups. In one group (n = 20) the rats were injected with ketamine intraperitoneally (i.p.) at PND 7 [8] and sacrificed within 24 h.'],N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",ketamine,['In one group (n = 20) the rats were injected with ketamine intraperitoneally (i.p.) at PND 7 [8] and sacrificed within 24 h.'],none,[],sprague dawley,['Seven-day-old male and female Sprague Dawley rats (body weight 11.1–17.5 g) were housed in plastic cages with their mothers and maintained on a 12: 12 h light/dark cycle at 22–25°C ambient temperature with food and water available ad libitum for the mothers.'],True,True,True,True,True,True,[ Passage 7/25 ] 10.1097/EJA.0b013e328330d453
 10.1007/s12640-016-9615-7,341.0,Huang,2016,rats,postnatal day 7,Y,ketamine,none,sprague dawley,"PMID: 26966008 DOI: 10.1007/s12640-016-9615-7
 Materials and Methods
 Animal Treatment
@@ -218,7 +218,7 @@ Morris Water Maze Test
 The hippocampal-dependent spatial memory abilities were tested by using the Morris water maze (MWM). Different set of rats were tested 2 months after administration of ketamine on PND-7. A circular, black painted pool (180 cm diameter, 50 cm deep) was filled with water to a depth of 30 cm. The water temperature was maintained at 25 ± 1 °C. An invisible platform (10 cm diameter) was submerged 1 cm below the water surface and placed in the center of the III quadrant which was determined with four starting locations called I, II, III, and IV at equal distance on the edge of the pool. During five consecutive days, the experiments were conducted in a dark and quiet laboratory, all the rats were trained four times per day, the starting positions were random for each rat. When the rat found the platform, the rat was allowed to stay on it for 30 s. If a rat did not find the platform within 120 s, the rat would be guided gently to the place and allowed to stay on it for 30 s, and the latency time to find the hidden platform was recorded as 120 s. The average time from four trials represented as the daily result for the rat. On the sixth day, the hidden platform was removed, and the rat was placed in the opposite quadrant. Rats were allowed to swim freely for 120 s. The numbers the rat swam to cross the previous platform area, and the times the rat stayed in the target quadrant within 120 s were recorded. Each animal’s path was tracked by a computerizing video system. After every trial, each rat was placed in a heater plates for 1 to 2 min until dry before being returned to its chamber. The data were analyzed using software for the MWM (Jiangsu Province Key Laboratory of Anesthesiology, Xuzhou Medical College, Xuzhou, China).
 
 Statistical Analysis
-The statistical analysis was conducted using SPSS 13.0, and the graphs were created using GraphPad Prism 5. The data were analyzed using Mann-Whitney U test. The interaction between time and group factors in a two-way ANOVA was used to analyze the difference of escape latency between rats in the control group and rats treated with ketamine in the MWM. The data are presented as the mean ± SD, and p < 0.05 was considered statistically significant.",rats,['The timed-pregnant Sprague–Dawley rats were housed in a temperature-controlled (22–23 °C) room on a 12 h:12 h light:dark cycle (light on at 8:00 AM) with free access to food and water.'],postnatal day 7,['The PND-7 male rat pups (11–14 g) were randomly assigned to ketamine-treated and control groups.'],Y,['The hippocampal-dependent spatial memory abilities were tested by using the Morris water maze (MWM).'],ketamine,"['In the treated group, ketamine was diluted in 0.9 % normal saline, and PND-7 rats were intraperitoneally administered with 40 mg/kg doses of ketamine in four injections at 1 h intervals (40 mg/kg × 4 injections).']",none,[],sprague dawley,['The timed-pregnant Sprague–Dawley rats were housed in a temperature-controlled (22–23 °C) room on a 12 h:12 h light:dark cycle (light on at 8:00 AM) with free access to food and water.'],True,True,True,True,True,True,10.1007/s12640-016-9615-7
+The statistical analysis was conducted using SPSS 13.0, and the graphs were created using GraphPad Prism 5. The data were analyzed using Mann-Whitney U test. The interaction between time and group factors in a two-way ANOVA was used to analyze the difference of escape latency between rats in the control group and rats treated with ketamine in the MWM. The data are presented as the mean ± SD, and p < 0.05 was considered statistically significant.",rats,['The timed-pregnant Sprague–Dawley rats were housed in a temperature-controlled (22–23 °C) room on a 12 h:12 h light:dark cycle (light on at 8:00 AM) with free access to food and water.'],postnatal day 7,['The PND-7 male rat pups (11–14 g) were randomly assigned to ketamine-treated and control groups.'],Y,['The hippocampal-dependent spatial memory abilities were tested by using the Morris water maze (MWM).'],ketamine,"['In the treated group, ketamine was diluted in 0.9 % normal saline, and PND-7 rats were intraperitoneally administered with 40 mg/kg doses of ketamine in four injections at 1 h intervals (40 mg/kg × 4 injections).']",none,[],sprague dawley,['The timed-pregnant Sprague–Dawley rats were housed in a temperature-controlled (22–23 °C) room on a 12 h:12 h light:dark cycle (light on at 8:00 AM) with free access to food and water.'],True,True,True,True,True,True,[ Passage 8/25 ] 10.1007/s12640-016-9615-7
 10.1186/s12871-018-0471-2,1187.0,Huang,2018,rats,gestational day 21,Y,isoflurane,none,sprague dawley,"PMID: 29325538 PMCID: PMC5765622 DOI: 10.1186/s12871-018-0471-2
 Methods
 This study was approved by the Ethics Committee of Affiliated Shengjing Hospital of China Medical University, and specific pathogen free SD pregnant rats weighing 380–420 g were purchased from the Experimental Animal Center of Affiliated Shengjing Hospital of China Medical University. Animals were housed at 22–24 °C, 40–60% humidity with a 12-h light /dark cycle and had free access to food and water. Rats at the gestational age of 21 days (E21) were used in subsequent experiments. According to the isoflurane dose, rats were divided into 3 groups: the Iso1 group (1.3% isoflurane), the Iso2 group (2.0% isoflurane) and the control group (0% isoflurane; O2).
@@ -232,7 +232,7 @@ MWM test used a round swimming pool sized 150 cm in diameter and 60 cm in height
 Place navigation test was performed for consecutive 5 days. In brief, platform were placed in a quadrant (the 4th quadrant in this study). At predesigned time point, rats were placed in a random quadrant (once for each quadrant). If the rat found the platform within 90s, it was allowed to stay on the platform for 15 s and then placed out of the pool. The spatial navigation test was performed on the 6th day to evaluate memory. In brief, the platform was removed, rats were placed in a random quadrant and the swimming trajectory was recorded within 90s. In the test, the proportion of swimming distance in the platform quadrant to the total swimming distance and the times of crossing the platform were calculated. The swimming distance in the platform quadrant reflects spatial localization and the times of crossing the platform reflects the accuracy of spatial memory. Before training, the platform was visible above the water surface, which may exclude rats with visual defects that were unable to find the platform. In addition, rats with poor performance in the test, such as those could not find the hidden platform and swam along the wall, were also excluded from this study.
 
 Two hours after the spatial navigation test, rats were intraperitoneally anesthetized with pentobarbital sodium. Half of each group of the rats were used to collect brain and followed by the separation of hippocampus. The hippocampus was weighed and lysed for total protein extraction. Samples were then stored at −80 °C for later use. Western blotting was performed to detect the protein expression of CREB and p-CREB in the hippocampus. The half of the rats were transcardially perfused with 4% paraformaldehyde and the brain was collected and fixed in 4% paraformaldehyde. Immunohistochemistry was performed to detect CREB and p-CREB expression. (Fig. 1).
-The neonatal rats were randomly assigned into different groups to reduce variation. We normalized CREB and p-CREB protein expression in control group as 1. CREB and p-CREB expression in the Iso1 and Iso2 group was compared with the controls. All data are expressed as mean ± standard deviation. Statistical analyses were performed by using SPSS software (version 21.0; IBM, Corp., Armonk, NY, USA). One-Way ANOVA was used to compare the means between groups. A value of P < 0.05 indicated significance.",rats,['specific pathogen free SD pregnant rats weighing 380–420 g were purchased from the Experimental Animal Center of Affiliated Shengjing Hospital of China Medical University.'],gestational day 21,['Rats at the gestational age of 21 days (E21) were used in subsequent experiments.'],Y,"['At day 28 after birth (P28), the male offsprings were randomly assigned into two groups: one for Morris water maze (MWM) test to evaluate memory and learning and the other one were housed until day 90 after birth (P90) to receive the same MWM test.']",isoflurane,"['According to the isoflurane dose, rats were divided into 3 groups: the Iso1 group (1.3% isoflurane), the Iso2 group (2.0% isoflurane) and the control group (0% isoflurane; O2).']",none,[],sprague dawley,['specific pathogen free SD pregnant rats weighing 380–420 g were purchased from the Experimental Animal Center of Affiliated Shengjing Hospital of China Medical University.'],True,True,True,True,True,True,10.1186/s12871-018-0471-2
+The neonatal rats were randomly assigned into different groups to reduce variation. We normalized CREB and p-CREB protein expression in control group as 1. CREB and p-CREB expression in the Iso1 and Iso2 group was compared with the controls. All data are expressed as mean ± standard deviation. Statistical analyses were performed by using SPSS software (version 21.0; IBM, Corp., Armonk, NY, USA). One-Way ANOVA was used to compare the means between groups. A value of P < 0.05 indicated significance.",rats,['specific pathogen free SD pregnant rats weighing 380–420 g were purchased from the Experimental Animal Center of Affiliated Shengjing Hospital of China Medical University.'],gestational day 21,['Rats at the gestational age of 21 days (E21) were used in subsequent experiments.'],Y,"['At day 28 after birth (P28), the male offsprings were randomly assigned into two groups: one for Morris water maze (MWM) test to evaluate memory and learning and the other one were housed until day 90 after birth (P90) to receive the same MWM test.']",isoflurane,"['According to the isoflurane dose, rats were divided into 3 groups: the Iso1 group (1.3% isoflurane), the Iso2 group (2.0% isoflurane) and the control group (0% isoflurane; O2).']",none,[],sprague dawley,['specific pathogen free SD pregnant rats weighing 380–420 g were purchased from the Experimental Animal Center of Affiliated Shengjing Hospital of China Medical University.'],True,True,True,True,True,True,[ Passage 9/25 ] 10.1186/s12871-018-0471-2
 10.1213/ANE.0b013e318281e988,407.0,Istaphanous,2013,mice,postnatal day 7,N,isoflurane,none,none,"PMID: 23460572 DOI: 10.1213/ANE.0b013e318281e988
 METHODS
 All procedures were approved by the Institutional Animal Care and Use Committee and conformed to the guidelines for ethical treatment of animals. Efforts were made to minimize the number of animals used. Breeding pairs of male CD1 and female C57BL/6 mice were housed in a 12/12-hour light-dark cycle at 22°C with free access to food and water. This hybrid was selected because they exhibit robust anesthesia-induced apoptosis with acceptable survival.3
@@ -263,7 +263,7 @@ The Poisson mean event rate, λ, and its 95% CI were determined using the MATLAB
 
 The raw event counts were used to compute the ratio of events in the anesthesia-treated group to the control group using equations 6 and 7 in Graham et al.14 This method was used as an independent means to assess the mean event ratio and to determine the 95% CI for the event ratio.
 
-All other data are presented as means ± SEM. Group comparisons were made using the Mann-Whitney U test. Statistical calculations were analyzed using Stata/IC 10.1 for Mac OS X (Stata Corp., College Station, TX). Statistical significance was accepted at P < 0.05.",mice,['Breeding pairs of male CD1 and female C57BL/6 mice were housed in a 12/12-hour light-dark cycle at 22°C with free access to food and water.'],postnatal day 7,"['For caspase 3 immunohistochemistry, 7-day-old CD1 and C57BL/6 hybrid littermates (n = 14) were randomly assigned to a 6-hour exposure to 1.5% isoflurane...']",N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",isoflurane,"['For caspase 3 immunohistochemistry, 7-day-old CD1 and C57BL/6 hybrid littermates (n = 14) were randomly assigned to a 6-hour exposure to 1.5% isoflurane...']",none,[],c57bl/6,['Breeding pairs of male CD1 and female C57BL/6 mice were housed in a 12/12-hour light-dark cycle at 22°C with free access to food and water.'],True,True,True,True,True,False,10.1213/ANE.0b013e318281e988
+All other data are presented as means ± SEM. Group comparisons were made using the Mann-Whitney U test. Statistical calculations were analyzed using Stata/IC 10.1 for Mac OS X (Stata Corp., College Station, TX). Statistical significance was accepted at P < 0.05.",mice,['Breeding pairs of male CD1 and female C57BL/6 mice were housed in a 12/12-hour light-dark cycle at 22°C with free access to food and water.'],postnatal day 7,"['For caspase 3 immunohistochemistry, 7-day-old CD1 and C57BL/6 hybrid littermates (n = 14) were randomly assigned to a 6-hour exposure to 1.5% isoflurane...']",N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",isoflurane,"['For caspase 3 immunohistochemistry, 7-day-old CD1 and C57BL/6 hybrid littermates (n = 14) were randomly assigned to a 6-hour exposure to 1.5% isoflurane...']",none,[],c57bl/6,['Breeding pairs of male CD1 and female C57BL/6 mice were housed in a 12/12-hour light-dark cycle at 22°C with free access to food and water.'],True,True,True,True,True,False,[ Passage 10/25 ] 10.1213/ANE.0b013e318281e988
 10.1016/j.bja.2018.04.034,740.0,Ju,2018,rats,postnatal day 5,Y,sevoflurane,none,sprague dawley,"PMID: 30032879 PMCID: PMC6200111 DOI: 10.1016/j.bja.2018.04.034
 
 Methods
@@ -283,7 +283,7 @@ The mRNA levels for Nkcc1, Kcc2 in the PVN of the hypothalamus and hippocampus,
 Bisulphite sequencing
 Genomic DNA was extracted from the sperm pellet and ovaries of adult F0 rats and from hippocampal and hypothalamic tissues of P5 F1 rats using the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany). The sodium bisulfite conversion was performed with EZ DNA Methylation kits (Zymo Research, Irvine, CA, USA) following the manufacturer's instructions. The primers (Nkcc1: forward: GAGAGGAGTTTATAGGGTT; reverse: AACCCTAC(A/G)CTAACCAACCTC; Kcc2: forward: GATTGTAAGTGTTTTTATTATTGAGTTGTATATT; reverse: AATAAACTTTTCCCCTTTTATACCC) were designed for the bisulfite-converted DNA sequences, using previously published sequences.23,24 PCR amplification was performed with HotStar Taq (Qiagen). Amplicons were cloned into pCR4-TOPO vector with the TOPO TA cloning kit for sequencing (Life Technologies, Carlsbad, CA, USA). Miniprep was performed on each positive clone using ZR Plasmid Miniprep kit (Zymo Research). Sanger sequencing was done by Genewiz (South Plainfield, NJ, USA) using M13R primers. The DNA methylation status of all CpG sites was analysed using Benchling Molecular Biology 2.0 Software (Benchling, San Francisco, CA, USA).
 Statistical analysis
-Values are reported as mean (standard deviation). Statistical analyses were carried out on raw data using SigmaPlot 13.0 software (Systat Software, Inc., San Jose, CA, USA). To assess differences in total corticosterone concentration, EPM behaviour and gene expression for Nkcc1, Kcc2, and Gr, t-test and one way analysis of variance (ANOVA) were used for F0 and F1 generations, respectively. Two way ANOVA with experimental groups and time as the independent variables was run to analyse changes in serum corticosterone concentrations at rest and at three time points after the restraint. Two way ANOVA was used to analyse the PPI data, with the treatment and prepulse intensity as independent variables, and the MWM latencies to escape data, with experimental groups and days of training as the independent variables. One-way ANOVA was used to analyse time spent in the target quadrant and numbers of crossings during the MWM probe test. Two way measures ANOVA with treatment as ‘between’-subject factor and CpG site as ‘within’-subject factor was used to analyse the frequency methylation of CpG sites. Multiple pairwise comparisons were done with the Holm-Sidak method. All comparisons were run as two-tailed tests. A P value <0.05 was considered significant. The sample sizes in this study were based on previous experience with the same experimental techniques.6,  7,  8",rats,"['Sprague-Dawley rats were housed under controlled illumination (12-h light/dark, lights on at 7:00AM) and temperature (23–24°C) with free access to food and water.']",postnatal day 5,['The P5 male and female rat pups were kept in a temperature-controlled chamber (37ºC) with a continuous supply of 30% oxygen in air (1.5 L min−1) during anaesthesia with 6 vol% sevoflurane for 3 min for induction and 2.1 vol% sevoflurane for 357 min as maintenance (sevoflurane group).'],Y,"['The F0 male and female rats were sequentially evaluated on the elevated plus maze (EPM) starting on P60, for prepulse inhibition (PPI) of the acoustic startle response on P70, and for corticosterone responses to physical restraint for 30 min on ≥P160 followed by isolation of brain and gamete tissue samples for further analyses (Fig. 1).', 'The F1 rats, 144 in total [n=18 per sex (two) per group (four)], which were subjected to facility rearing only, were evaluated in the EPM starting on P60, PPI of startle on P70, Morris water maze (MWM) testing starting on P79, and for the corticosterone responses to restraint for 30 min on ≥P90, followed by isolation of brain tissue samples for further analyses.']",sevoflurane,['The P5 male and female rat pups were kept in a temperature-controlled chamber (37ºC) with a continuous supply of 30% oxygen in air (1.5 L min−1) during anaesthesia with 6 vol% sevoflurane for 3 min for induction and 2.1 vol% sevoflurane for 357 min as maintenance (sevoflurane group).'],none,[],sprague dawley,"['Sprague-Dawley rats were housed under controlled illumination (12-h light/dark, lights on at 7:00AM) and temperature (23–24°C) with free access to food and water.']",True,True,True,True,True,True,10.1016/j.bja.2018.04.034
+Values are reported as mean (standard deviation). Statistical analyses were carried out on raw data using SigmaPlot 13.0 software (Systat Software, Inc., San Jose, CA, USA). To assess differences in total corticosterone concentration, EPM behaviour and gene expression for Nkcc1, Kcc2, and Gr, t-test and one way analysis of variance (ANOVA) were used for F0 and F1 generations, respectively. Two way ANOVA with experimental groups and time as the independent variables was run to analyse changes in serum corticosterone concentrations at rest and at three time points after the restraint. Two way ANOVA was used to analyse the PPI data, with the treatment and prepulse intensity as independent variables, and the MWM latencies to escape data, with experimental groups and days of training as the independent variables. One-way ANOVA was used to analyse time spent in the target quadrant and numbers of crossings during the MWM probe test. Two way measures ANOVA with treatment as ‘between’-subject factor and CpG site as ‘within’-subject factor was used to analyse the frequency methylation of CpG sites. Multiple pairwise comparisons were done with the Holm-Sidak method. All comparisons were run as two-tailed tests. A P value <0.05 was considered significant. The sample sizes in this study were based on previous experience with the same experimental techniques.6,  7,  8",rats,"['Sprague-Dawley rats were housed under controlled illumination (12-h light/dark, lights on at 7:00AM) and temperature (23–24°C) with free access to food and water.']",postnatal day 5,['The P5 male and female rat pups were kept in a temperature-controlled chamber (37ºC) with a continuous supply of 30% oxygen in air (1.5 L min−1) during anaesthesia with 6 vol% sevoflurane for 3 min for induction and 2.1 vol% sevoflurane for 357 min as maintenance (sevoflurane group).'],Y,"['The F0 male and female rats were sequentially evaluated on the elevated plus maze (EPM) starting on P60, for prepulse inhibition (PPI) of the acoustic startle response on P70, and for corticosterone responses to physical restraint for 30 min on ≥P160 followed by isolation of brain and gamete tissue samples for further analyses (Fig. 1).', 'The F1 rats, 144 in total [n=18 per sex (two) per group (four)], which were subjected to facility rearing only, were evaluated in the EPM starting on P60, PPI of startle on P70, Morris water maze (MWM) testing starting on P79, and for the corticosterone responses to restraint for 30 min on ≥P90, followed by isolation of brain tissue samples for further analyses.']",sevoflurane,['The P5 male and female rat pups were kept in a temperature-controlled chamber (37ºC) with a continuous supply of 30% oxygen in air (1.5 L min−1) during anaesthesia with 6 vol% sevoflurane for 3 min for induction and 2.1 vol% sevoflurane for 357 min as maintenance (sevoflurane group).'],none,[],sprague dawley,"['Sprague-Dawley rats were housed under controlled illumination (12-h light/dark, lights on at 7:00AM) and temperature (23–24°C) with free access to food and water.']",True,True,True,True,True,True,[ Passage 11/25 ] 10.1016/j.bja.2018.04.034
 10.1371/journal.pbio.2001246,384.0,Kang,2017,mice,postnatal day 18,Y,isoflurane,none,c57bl/6,"PMID: 28683067 PMCID: PMC5500005 DOI: 10.1371/journal.pbio.2001246
 Methods
 Ethics
@@ -313,7 +313,7 @@ Rapamycin treatment
 P21 mouse littermates were given IP injections of rapamycin (Sigma-Aldrich, St. Louis, MO) prepared from a stock solution (25 mg/ml in 100% ethanol, stored at -20°C) diluted to a final concentration of 4% (v/v) ethanol in the vehicle. Vehicle consisted of 5% Tween 80 (Sigma-Aldrich, St. Louis, MO) and 10% polyethylene glycol 400 (Sigma-Aldrich, St. Louis, MO) as previously described [58,60,61]. Both rapamycin- and vehicle-treated mice received the same volume for each injection (200 μl). Mice received treatments at 48 hour intervals from P21 to P29.
 
 Statistics
-Results are expressed as mean ± SEM. A one-tailed Student t test or ANOVA with Bonferroni test for intergroup comparisons were used for most statistical comparisons between groups as described in the figure legends using Prism Software (Graphpad Software Inc, La Jolla, CA). For Sholl analysis ANOVA was used at each point to test for differences between distributions. All data examined with parametric tests were determined to be normally distributed, and the criteria for statistical significance was set a priori at p < 0.05. Sample sizes were predicted based on experience from previous similar work [24]. All relevant data are available from the authors.",mice,['All study protocols involving mice were approved by the Animal Care and Use Committee at the Johns Hopkins University (protocol MO14M315) and conducted in accordance with the NIH guidelines for care and use of animals.'],postnatal day 18,['Isoflurane treatment and physiologic monitoring of sentinel animals P18 mouse littermates were randomly assigned to 2 groups.'],Y,"['Behavioral tests Sixty-day-old mice housed in groups (5 mice per cage) were handled for at least 2 minutes per day for 3 days before the start of the behavioral experiments.', 'Object-place recognition test Object-place recognition was performed as previously described [37].', 'Y-maze test In the Y-maze test, mice were released from the start arm (no visual cue) and allowed to habituate to only 1 out of 2 possible choice arms (overt visual cue) for 15 minutes.']",isoflurane,"['In Group 1 (isoflurane), mice were exposed to 1.5% isoflurane carried in 100% oxygen for 4 hours.']",ketamine,"['After induction with a single ketamine injection (50mg/kg), high titers of GFP-expressing retroviruses were stereotaxically injected into the P15 mice dentate gyrus.']",c57bl/6,"['C57BL/6 mice were housed in a temperature- and humidity-controlled room with a 12:12 hour light:dark cycle, and provided with ad libitum access to water and food.']",True,True,True,True,False,True,10.1371/journal.pbio.2001246
+Results are expressed as mean ± SEM. A one-tailed Student t test or ANOVA with Bonferroni test for intergroup comparisons were used for most statistical comparisons between groups as described in the figure legends using Prism Software (Graphpad Software Inc, La Jolla, CA). For Sholl analysis ANOVA was used at each point to test for differences between distributions. All data examined with parametric tests were determined to be normally distributed, and the criteria for statistical significance was set a priori at p < 0.05. Sample sizes were predicted based on experience from previous similar work [24]. All relevant data are available from the authors.",mice,['All study protocols involving mice were approved by the Animal Care and Use Committee at the Johns Hopkins University (protocol MO14M315) and conducted in accordance with the NIH guidelines for care and use of animals.'],postnatal day 18,['Isoflurane treatment and physiologic monitoring of sentinel animals P18 mouse littermates were randomly assigned to 2 groups.'],Y,"['Behavioral tests Sixty-day-old mice housed in groups (5 mice per cage) were handled for at least 2 minutes per day for 3 days before the start of the behavioral experiments.', 'Object-place recognition test Object-place recognition was performed as previously described [37].', 'Y-maze test In the Y-maze test, mice were released from the start arm (no visual cue) and allowed to habituate to only 1 out of 2 possible choice arms (overt visual cue) for 15 minutes.']",isoflurane,"['In Group 1 (isoflurane), mice were exposed to 1.5% isoflurane carried in 100% oxygen for 4 hours.']",ketamine,"['After induction with a single ketamine injection (50mg/kg), high titers of GFP-expressing retroviruses were stereotaxically injected into the P15 mice dentate gyrus.']",c57bl/6,"['C57BL/6 mice were housed in a temperature- and humidity-controlled room with a 12:12 hour light:dark cycle, and provided with ad libitum access to water and food.']",True,True,True,True,False,True,[ Passage 12/25 ] 10.1371/journal.pbio.2001246
 10.1016/j.bcp.2012.06.001,470.0,Kong,2012,rats,gestational day 14,Y,isoflurane,none,none,"PMID: 22705347 DOI: 10.1016/j.bcp.2012.06.001
 2. Materials and methods
 2.1. Animals
@@ -341,7 +341,7 @@ After the Morris Water Maze test, two pups from each dam were anesthetized by in
 Caspase-3 positive cells were measured in the hippocampal CA1 region, using immunohistochemical methods described previously [7], [8]. The brain region was chosen because it is particularly vulnerable to anesthesia-induced neurodegeneration [1] and is important to memory and learning. Briefly, the sections mentioned above were washed in 0.01 M PBS containing 0.3% Triton X-100 (pH 7.4, PBS-T), followed by blocking in 5% normal goat serum in 0.01 M PBS. The sections were then incubated in the primary antibodies rabbit polyclonal against anti-caspase-3 (1:200, Santa Cruz Biotechnology, USA) overnight at 4 °C. After a thorough wash in PBS, sections were incubated with biotinylated goat anti-rabbit IgG antibody (1:200, Wuhan Boster Biological Technology, Ltd., China) for 2 h at room temperature, followed by avidin–biotin–peroxidase complex solution (ABC, 1:100, Wuhan Boster Biological Technology, Ltd., China) for 2 h at room temperature. Immunolabeling was visualized with 0.05% diaminobenzdine (DAB, Wuhan Boster Biological Technology, Ltd., China) plus 0.3% H2O2 in PBS and the reaction was stopped by rinsing the slides with 0.2 M Tris–HCl. Sections were mounted onto 0.02% poly-l-lysinecoated slides and allowed to dry at room temperature. Then the sections were dehydrated through a graded series of alcohols, cleared in xylene and finally coverslipped. Rat Immunoglobulin IgG (1:200, Biomeda Corporation, USA) was used instead of primary antibody as a negative control. Other chemicals used in this study were provided by Cell Signaling Technology (Beverly, MA). Three sections from hippocampal CA1 region of each animal were randomly selected and images were photographed under 400× magnification in 3 visual fields/per section, the caspase-3 positive neurons were counted in the same area. The optical densities of caspase-3 positive neurons were measured quantitatively using Image-Pro Plus version 6.0 (Media Cybernetics, Inc., Silver Spring, USA). The optical density of caspase-3 positive cells in a particular brain region was calculated by dividing the integrated optical density of caspase-3 positive cells by the area of that brain region.
 
 2.7. Statistical analysis
-All data were presented as mean ± S.E.M. Results of weight of postnatal rat pups and place trials of postnatal rats were analyzed using 2-way ANOVA for repeated measurements. Other data were analyzed using one-way ANOVA, followed by Tukey post hoc multiple comparison tests. A P value of <0.05 was considered statistically significant. All statistical tests and graphs were performed or generated, respectively, using Graph-Pad Prism Version 4.0 (GraphPad Prism Software, Inc., CA, USA).",rats,"['The dams were housed in polypropylene cages, and the room temperature was maintained at 22 °C, with a 12-h light–dark cycle.']",gestational day 14,"['The dams at gestational day 14 were used for all experiments, because this time corresponds approximately to mid-gestation in humans [15], [16], the period when most non-obstetric surgeries and fetal interventions are performed [9], [10].']",Y,['Four rat pups (2 females and 2 males) from each dam were selected to determine cognitive function at postnatal day 28 with a Morris Water Maze test with minor modifications [1].'],isoflurane,"['The dams were randomly divided into three groups: control, low concentration of isoflurane (1.3%), and high concentration of isoflurane (3%) treatment groups (n = 8).']",none,[],not specified,[],True,True,True,True,True,False,10.1016/j.bcp.2012.06.001
+All data were presented as mean ± S.E.M. Results of weight of postnatal rat pups and place trials of postnatal rats were analyzed using 2-way ANOVA for repeated measurements. Other data were analyzed using one-way ANOVA, followed by Tukey post hoc multiple comparison tests. A P value of <0.05 was considered statistically significant. All statistical tests and graphs were performed or generated, respectively, using Graph-Pad Prism Version 4.0 (GraphPad Prism Software, Inc., CA, USA).",rats,"['The dams were housed in polypropylene cages, and the room temperature was maintained at 22 °C, with a 12-h light–dark cycle.']",gestational day 14,"['The dams at gestational day 14 were used for all experiments, because this time corresponds approximately to mid-gestation in humans [15], [16], the period when most non-obstetric surgeries and fetal interventions are performed [9], [10].']",Y,['Four rat pups (2 females and 2 males) from each dam were selected to determine cognitive function at postnatal day 28 with a Morris Water Maze test with minor modifications [1].'],isoflurane,"['The dams were randomly divided into three groups: control, low concentration of isoflurane (1.3%), and high concentration of isoflurane (3%) treatment groups (n = 8).']",none,[],not specified,[],True,True,True,True,True,False,[ Passage 13/25 ] 10.1016/j.bcp.2012.06.001
 10.1016/j.brainres.2015.10.050,1730.0,Lai,2016,rats,postnatal day 7,Y,sevoflurane,none,sprague dawley,"PMID: 26541582 DOI: 10.1016/j.brainres.2015.10.050
 4. Experimental procedures
 4.1. Animals
@@ -369,7 +369,7 @@ Proteins were separated on a 12% SDS-PAGE gel, and then transferred to a nitroce
 Preparation of mitochondria was adapted from a procedure described previously (Wu et al., 2006). All procedures were carried out in the cold (0–4 °C). Hippocampal pieces were placed in isolation buffer (250 mmol/L sucrose, 210 mmol/L mannitol, 1 mmol/L K-EDTA, 10 mmol/L Tris–HCl, pH 7.4) and homogenized (10 mL buffer/g). The homogenate was immediately centrifuged at 2000g for 3 min. The supernatant was centrifuged again at 2000g for 3 min, the second supernatant was decanted and centrifuged at 12,000g for 8 min, and the resulting supernatant was decanted and resuspended in isolation buffer without K-EDTA. The suspension was centrifuged at 12,000g for 10 min and the resulting mitochondrial pellet was resuspended in the same buffer. Mitochondrial protein concentration was quantified according to the Bradford׳s method using 1 g/mL bovine serum albumin (BSA) as standard. Purity and integrity of isolated mitochondria were confirmed by neutral red-Janus green B staining (Sigma, USA). Isolated mitochondria from the hippocampus (0.5 mg protein) was resuspended in swelling buffer (71 mmol/L sucrose, 215 mmol/L mannitol, and 10 mmol/L sodium succinate in 5 mmol/L HEPES, pH 7.4) to a final volume of 2 mL, and incubated at 25 °C for 2 min. mPTP-induced mitochondrial swelling was confirmed by 5 min incubation with the strong mPTP inhibitor CsA before addition of CaCl2, and was measured with a spectrophotometer (Beckman DU800, USA) as a reduction in optical density at 540 nm (OD540) (Kristal and Brown, 1999, Baines et al., 2003).
 
 4.9. Statistical analysis
-All data were presented as mean±standard deviation (SD). For comparison between multiple groups, data were analyzed by one-way ANOVA. When a statistical difference was determined by ANOVA, the least significant difference (LSD) procedure was applied. The percentage of search strategies were examined by the Mann–Whitney method, and repetitive measure ANOVA was used to measure mean EL at different time points. Spatial probe trial data were analyzed by one-way ANOVA and principal components analysis (PCA). All analyses were performed with SPSS 13.0 for Windows, and a value of P<0.05 was considered significant.",rats,"['A total of 240 male and female clean Sprague-Dawley rats, 7 days of age and weighting 12–16 g, (Shanghai Slac Laboratory Animal Co., Ltd., China) were used in this study.']",postnatal day 7,"['A total of 240 male and female clean Sprague-Dawley rats, 7 days of age and weighting 12–16 g, (Shanghai Slac Laboratory Animal Co., Ltd., China) were used in this study.']",Y,"['The rats were evaluated with a nonspatial object recognition memory task 25 days after the intervention as described by Ennaceur and Delacour (1988) and Bruel-Jungerman et al. (2005).', 'After the novel object recognition test, the Morris water maze was used to test spatial learning and memory (Peng et al., 2012, Jiang et al., 2004).']",sevoflurane,"['For sevoflurane postconditioning, the animals were placed in a chamber containing 2.5% sevoflurane in 30% O2–70% N2 for 30 min after cerebral HI injury.']",none,[],sprague dawley,"['A total of 240 male and female clean Sprague-Dawley rats, 7 days of age and weighting 12–16 g, (Shanghai Slac Laboratory Animal Co., Ltd., China) were used in this study.']",True,True,True,True,True,True,10.1016/j.brainres.2015.10.050
+All data were presented as mean±standard deviation (SD). For comparison between multiple groups, data were analyzed by one-way ANOVA. When a statistical difference was determined by ANOVA, the least significant difference (LSD) procedure was applied. The percentage of search strategies were examined by the Mann–Whitney method, and repetitive measure ANOVA was used to measure mean EL at different time points. Spatial probe trial data were analyzed by one-way ANOVA and principal components analysis (PCA). All analyses were performed with SPSS 13.0 for Windows, and a value of P<0.05 was considered significant.",rats,"['A total of 240 male and female clean Sprague-Dawley rats, 7 days of age and weighting 12–16 g, (Shanghai Slac Laboratory Animal Co., Ltd., China) were used in this study.']",postnatal day 7,"['A total of 240 male and female clean Sprague-Dawley rats, 7 days of age and weighting 12–16 g, (Shanghai Slac Laboratory Animal Co., Ltd., China) were used in this study.']",Y,"['The rats were evaluated with a nonspatial object recognition memory task 25 days after the intervention as described by Ennaceur and Delacour (1988) and Bruel-Jungerman et al. (2005).', 'After the novel object recognition test, the Morris water maze was used to test spatial learning and memory (Peng et al., 2012, Jiang et al., 2004).']",sevoflurane,"['For sevoflurane postconditioning, the animals were placed in a chamber containing 2.5% sevoflurane in 30% O2–70% N2 for 30 min after cerebral HI injury.']",none,[],sprague dawley,"['A total of 240 male and female clean Sprague-Dawley rats, 7 days of age and weighting 12–16 g, (Shanghai Slac Laboratory Animal Co., Ltd., China) were used in this study.']",True,True,True,True,True,True,[ Passage 14/25 ] 10.1016/j.brainres.2015.10.050
 10.1371/journal.pone.0070645,564.0,Lei,2013,rats,postnatal day 7,Y,sevoflurane,none,sprague dawley,"PMID: 23967080 PMCID: PMC3742769 DOI: 10.1371/journal.pone.0070645
 Materials and Methods
 Animal/Anesthesia treatment
@@ -402,7 +402,7 @@ Morris water maze memory consolidation Working memory (WM): On postnatal day 70
 Short-term memory (STM) and early long-term memory (ELTM): When the WM latencies of rats in task were plateaued on postnatal day 77 (P77), we increased the delay between the free swim and the subsequent trials. The delay was extended from 1 min on P77 to 1 h on postnatal day 78 (P78) to test STM, and then to 4 h on P79 to test ELTM. Performances on the last trial after the free swim on P77 (1-min delay), P78 (1-h delay), and P79 (4-h delay) were used as measures of WM, STM, and ELTM, respectively.
 
 Statistical methods
-All data are presented as mean ± standard deviation. We performed two-tailed t tests (assuming equal variances) to determine differences in cleaved caspase-3 immunohistochemistry and blood gas parameters between the control and sevoflurane groups. We used a one-way analysis of variance followed by Newman-Keuls post hoc tests to determine differences among groups for interactions between n-3 PUFAs or sevoflurane and cleaved caspase-3 activation, BrdU quantification, or neurobehavioral tests. For all tests, p<0.05 was considered statistically significant.",rats,['The rats used in the present study were obtained from the Animal Care Center of Fudan University.'],postnatal day 7,"['On postnatal day 7 (P7), the rat pups in the sevoflurane and sevoflurane with n-3 PUFAs groups received sevoflurane anesthesia.']",Y,"['We used only male offspring (n\u200a=\u200a9 per group) in the neurobehavioral tests to exclude estrogen influences on neurocognitive evaluations.', 'Morris water maze spatial reference memory Probe training: Rats trained for 4 consecutive days (postnatal days 35–38, P35–38) in the Morris water maze following treatment with a vehicle or 3% sevoflurane for 6 h.', 'Fear conditioning test Rats underwent fear conditioning tests on postnatal days 63–64 (P63–64).']",sevoflurane,['P7 rats were placed in a sealed box ventilated with 3% sevoflurane in 60% oxygen and treated for 6 h.'],none,[],sprague dawley,"['One-day pregnant female Sprague Dawley rats (weight 220–250 g) were randomly assigned to one of the three groups: control, sevoflurane, or sevoflurane with n-3 PUFAs (n\u200a=\u200a3 per group).']",True,True,True,True,True,True,10.1371/journal.pone.0070645
+All data are presented as mean ± standard deviation. We performed two-tailed t tests (assuming equal variances) to determine differences in cleaved caspase-3 immunohistochemistry and blood gas parameters between the control and sevoflurane groups. We used a one-way analysis of variance followed by Newman-Keuls post hoc tests to determine differences among groups for interactions between n-3 PUFAs or sevoflurane and cleaved caspase-3 activation, BrdU quantification, or neurobehavioral tests. For all tests, p<0.05 was considered statistically significant.",rats,['The rats used in the present study were obtained from the Animal Care Center of Fudan University.'],postnatal day 7,"['On postnatal day 7 (P7), the rat pups in the sevoflurane and sevoflurane with n-3 PUFAs groups received sevoflurane anesthesia.']",Y,"['We used only male offspring (n\u200a=\u200a9 per group) in the neurobehavioral tests to exclude estrogen influences on neurocognitive evaluations.', 'Morris water maze spatial reference memory Probe training: Rats trained for 4 consecutive days (postnatal days 35–38, P35–38) in the Morris water maze following treatment with a vehicle or 3% sevoflurane for 6 h.', 'Fear conditioning test Rats underwent fear conditioning tests on postnatal days 63–64 (P63–64).']",sevoflurane,['P7 rats were placed in a sealed box ventilated with 3% sevoflurane in 60% oxygen and treated for 6 h.'],none,[],sprague dawley,"['One-day pregnant female Sprague Dawley rats (weight 220–250 g) were randomly assigned to one of the three groups: control, sevoflurane, or sevoflurane with n-3 PUFAs (n\u200a=\u200a3 per group).']",True,True,True,True,True,True,[ Passage 15/25 ] 10.1371/journal.pone.0070645
 10.1111/jcmm.13524,1256.0,Lin,2018,rats,e7,Y,propofol,none,sprague dawley,"PMID: 29461008 PMCID: PMC5908131 DOI: 10.1111/jcmm.13524
 2. MATERIALS AND METHODS
 2.1. Drugs
@@ -432,7 +432,7 @@ The hippocampus (n = 6, with three male and three female offspring rats from eac
 Immunofluorescence staining was used to assess HDAC2 and phospho‐CREB in the hippocampus of offspring rats after the MWM test. Hippocampus from offspring rats (n = 6, with three male and three female offspring rats from each group) were fixated in paraformaldehyde. Five‐μm frozen sections of the hippocampus were used for the immunofluorescence staining. The sections were incubated with anti‐HDAC2 (1:300) and anti‐CREB (1:100) dissolved in 1% bovine serum albumin in phosphate‐buffered saline at 4°C overnight. Then, the sections were incubated with fluorescent‐conjugated anti‐rabbit secondary antibody (1:300) for 1 hour in the dark at room temperature. Negative control sections were incubated with PBS as a substitute for primary antibody. Finally, the sections were wet mounted and viewed immediately using a inverted fluorescence microscope (200×) (Olympus, Japan). The target protein was red, and nuclei were blue. The proteins of HDAC2 and p‐CREB were excited by the green light, while the DAPI was performed by UV blue light. All images were recorded at 10 × 20× (Exp Acq‐700mmm, Offset Acq‐1, Gain Acq‐1, Gamma Acq‐300). The density of HDCA2 and p‐CREB staining was conducted on the images using Image‐Pro Plus 6.0 (Media Cybernetics Inc., USA). The images were converted it into black and white pictures. After intensity calibration, hippocampal CA1 area was chosen to analyse and the integrated optical density (IOD) was measured. IOD/Area was calculated as the protein expression level.
 
 2.8. Statistical analysis
-All analyses were performed with SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA). Data from escape latency in the MWM test were subjected to a repeated measures two‐way analysis of variance (RM two‐way ANOVA) and were followed by least significant difference t (LSD‐t) analysis when a significant overall between‐subject factor was found (P < 0.05). Data from Western blot and immunofluorescence staining results were subjected to one‐way ANOVA analysis. All data well provided for any of the variables. The LSD t test was used to determine the difference between groups. Statistical significance was declared at P < .05.",rats,"['Sprague Dawley (SD) rats were purchased from the animal science research department of the Jiangxi Traditional Chinese Medicine College (JZDWNO: 2011-0030; Nanchang, Jiangxi,China).']",gestational day 7,"['On E7, pregnant rats received intravenous infusion of propofol (n = 10 dams) with the rate of 20 mg kg−1 h−1 for 4 hours, equal volume of saline (n = 10 dams) or intralipid (n = 5 dams), respectively.']",Y,"['Spatial learning and memory were assessed by the MWM test from post‐natal day 30 (P30) to P36 according to previously described5, 30 with SLY‐WMS Morris water maze test system (Beijing Sunny Instruments Co. Ltd., Beijing, China).']",propofol,"['On E7, pregnant rats received intravenous infusion of propofol (n = 10 dams) with the rate of 20 mg kg−1 h−1 for 4 hours, equal volume of saline (n = 10 dams) or intralipid (n = 5 dams), respectively.']",isoflurane,"['The day after the MWM test, rats were anaesthetized with isoflurane and killed by cervical dislocation.']",sprague dawley,"['Sprague Dawley (SD) rats were purchased from the animal science research department of the Jiangxi Traditional Chinese Medicine College (JZDWNO: 2011-0030; Nanchang, Jiangxi,China).']",True,False,True,True,False,True,10.1111/jcmm.13524
+All analyses were performed with SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA). Data from escape latency in the MWM test were subjected to a repeated measures two‐way analysis of variance (RM two‐way ANOVA) and were followed by least significant difference t (LSD‐t) analysis when a significant overall between‐subject factor was found (P < 0.05). Data from Western blot and immunofluorescence staining results were subjected to one‐way ANOVA analysis. All data well provided for any of the variables. The LSD t test was used to determine the difference between groups. Statistical significance was declared at P < .05.",rats,"['Sprague Dawley (SD) rats were purchased from the animal science research department of the Jiangxi Traditional Chinese Medicine College (JZDWNO: 2011-0030; Nanchang, Jiangxi,China).']",gestational day 7,"['On E7, pregnant rats received intravenous infusion of propofol (n = 10 dams) with the rate of 20 mg kg−1 h−1 for 4 hours, equal volume of saline (n = 10 dams) or intralipid (n = 5 dams), respectively.']",Y,"['Spatial learning and memory were assessed by the MWM test from post‐natal day 30 (P30) to P36 according to previously described5, 30 with SLY‐WMS Morris water maze test system (Beijing Sunny Instruments Co. Ltd., Beijing, China).']",propofol,"['On E7, pregnant rats received intravenous infusion of propofol (n = 10 dams) with the rate of 20 mg kg−1 h−1 for 4 hours, equal volume of saline (n = 10 dams) or intralipid (n = 5 dams), respectively.']",isoflurane,"['The day after the MWM test, rats were anaesthetized with isoflurane and killed by cervical dislocation.']",sprague dawley,"['Sprague Dawley (SD) rats were purchased from the animal science research department of the Jiangxi Traditional Chinese Medicine College (JZDWNO: 2011-0030; Nanchang, Jiangxi,China).']",True,False,True,True,False,True,[ Passage 16/25 ] 10.1111/jcmm.13524
 10.1016/j.bbrc.2022.01.022,462.0,Liu,2022,mice,postnatal day 6,Y,sevoflurane,none,c57bl/6,"PMID: 35063768 DOI: 10.1016/j.bbrc.2022.01.022
 2. Methods
 2.1. Animals
@@ -455,7 +455,7 @@ Sociability is characteristic of the mouse taking more time sniffing its conspec
 The brain tissues of neonatal mice were harvested on dry ice at 24 h after treatment. Next, the cortex and hippocampus were homogenized on ice using the immunoprecipitation buffer plus protease inhibitor. And then, the lysates were centrifuged at 15,000 rpm for 30 min at 4 °C. After that, the lysates were quantified for total protein by the bicinchoninic acid (BCA) protein assay kit (MultiSciences Biotech Co., Ltd. Cat: PQ0012, Lot: A91041). Finally, western blot was performed by the protocols to analyze protein levels in cortex and hippocampus. Neuroligin-1 antibody (1:1000; Santa Cruz Biotechnology, Inc.) was used to detect neuroligin-1 (101 kDa). PSD-95 antibody (1:1000; Cell Signaling Technology, Inc.) was used to detect PSD-95 (95 kDa). Anti–β-actin (1:5000; Sigma) was used to detect β-actin (42 kDa).
 
 2.6. Statistical analysis
-Data were expressed as Mean ± SD. Statistical analyses were performed by using GraphPad Prism 5.0 (San Diego, USA). Data representing social behavior of testing mice were normally distributed by Kolmogorov-Smirnov test. Data of each mouse from the left or right side were mutually exclusive, and two-tailed paired t-test was used to determine side preference, which was supported by other social studies [14,15]. Student's t-test was used to assess differences in the levels of Neuroligin-1 and PSD95 expression in cortex and hippocampus of mice. P values less than 0.05 (∗), 0.01 (∗∗) and 0.001 (∗∗∗) were considered statistically significant.",mice,"['Twenty-four female and six male C57BL/6 mice in breeding age were purchased from Zhaoyan Laboratory (Taicang, Jiangsu, China) for producing next generation of mice.']",postnatal day 6,"['On postnatal day 6, the neonatal mice were randomly assigned into two groups.']",Y,"['These subject mice were tested for social interaction behavior at one- and two-month-old.', 'Social interaction test is performed with the three-chambered social box, with three chambers (40 L × 20 W × 22 H cm) and two enclosures (7 ID × 15 H cm).']",sevoflurane,"['Twenty-eight mice (17 males and 11 female) received 3.0% sevoflurane in 60% oxygen for 2 h (Sevo), and thirty-one mice (11 males and 20 female) inhaled merely 60% oxygen for 2 h (Oxyg).']",none,[],c57bl/6,"['Twenty-four female and six male C57BL/6 mice in breeding age were purchased from Zhaoyan Laboratory (Taicang, Jiangsu, China) for producing next generation of mice.']",True,True,True,True,True,True,10.1016/j.bbrc.2022.01.022
+Data were expressed as Mean ± SD. Statistical analyses were performed by using GraphPad Prism 5.0 (San Diego, USA). Data representing social behavior of testing mice were normally distributed by Kolmogorov-Smirnov test. Data of each mouse from the left or right side were mutually exclusive, and two-tailed paired t-test was used to determine side preference, which was supported by other social studies [14,15]. Student's t-test was used to assess differences in the levels of Neuroligin-1 and PSD95 expression in cortex and hippocampus of mice. P values less than 0.05 (∗), 0.01 (∗∗) and 0.001 (∗∗∗) were considered statistically significant.",mice,"['Twenty-four female and six male C57BL/6 mice in breeding age were purchased from Zhaoyan Laboratory (Taicang, Jiangsu, China) for producing next generation of mice.']",postnatal day 6,"['On postnatal day 6, the neonatal mice were randomly assigned into two groups.']",Y,"['These subject mice were tested for social interaction behavior at one- and two-month-old.', 'Social interaction test is performed with the three-chambered social box, with three chambers (40 L × 20 W × 22 H cm) and two enclosures (7 ID × 15 H cm).']",sevoflurane,"['Twenty-eight mice (17 males and 11 female) received 3.0% sevoflurane in 60% oxygen for 2 h (Sevo), and thirty-one mice (11 males and 20 female) inhaled merely 60% oxygen for 2 h (Oxyg).']",none,[],c57bl/6,"['Twenty-four female and six male C57BL/6 mice in breeding age were purchased from Zhaoyan Laboratory (Taicang, Jiangsu, China) for producing next generation of mice.']",True,True,True,True,True,True,[ Passage 17/25 ] 10.1016/j.bbrc.2022.01.022
 10.1097/ALN.0b013e31819daedd,5173.0,Liu,2012,rats,postnatal day 7,N,isoflurane,none,sprague dawley,"PMID: 19352168 DOI: 10.1097/ALN.0b013e31819daedd
 Materials and Methods
 The study protocol was approved by the Home Office (London, United Kingdom) and conforms to the United Kingdom Animals (Scientific Procedures) Act of 1986.
@@ -483,7 +483,7 @@ The conditioning chamber was cubic (30 cm × 24 cm × 21 cm; Med Associates, Inc
 Afterwards, all animals received 6 cycles of 214 s of trace fear conditioning. The tone was presented for 16 s (2 kHz) followed by a trace interval of 18 s and subsequent foot shock (2 s, 0.85 mA). The rats were removed from the conditioning chamber 198 s after the last shock and returned to their home cage. The total time of the acquisition phase was 26 min. Acquisition time was defined as the time spent immobile after a shock divided by the intertrial interval. On the next day, trained rats were exposed to the same acquisition environment but received neither tone nor shock for 8 min (context test). The percentage of time an animal froze during the 8-min observation periods was calculated as the number of observations judged to be freezing divided by the total number of observations in 8 min (i.e. , 60 observations). Freezing time was assessed using VideoFreeze software (Med Associates Inc., Burlington, VT); therefore, the assessment can be considered objective. The percentage of freezing time (context results) and the area under curve were derived from plots between the percentage freezing time and trial time in the tone test and were used for statistical comparison (mean ± SD, n = 6 per group).
 
 Statistical Analyses
-The number of caspase-3–positive neurons in the cortex, thalamus, and hippocampus in each brain slice were counted by an observer blinded to the experimental protocol. Four brain slices were counted per animal. The immunohistochemical and behavioral data are presented as mean ± SD. Statistical analyses was performed by ANOVA followed by post hoc  Newman Keuls testing using the INSTAT (London, United Kingdom) program. P < 0.05 was set as significant.",both,"['Organotypic hippocampal slices were derived from postnatal day 8 or 9 C57Bl/6 mice pups (Harlan Laboratories, Huntingdon, United Kingdom)', 'Seven-day-old Sprague-Dawley rat pups were exposed to 6 h of 0.75% isoflurane in 25% oxygen or air in a temperature-controlled chamber']","postnatal day 7, postnatal day 8","['Organotypic hippocampal slices were derived from postnatal day 8 or 9 C57Bl/6 mice pups', 'Seven-day-old Sprague-Dawley rat pups were exposed to 6 h of 0.75% isoflurane']",Y,['The animals were allowed to mature until postnatal day 40 and then tested for hippocampal-dependent memory and learning function in a previously reported contextual fear-conditioning behavioral paradigm'],isoflurane,['Seven-day-old Sprague-Dawley rat pups were exposed to 6 h of 0.75% isoflurane in 25% oxygen or air in a temperature-controlled chamber'],none,[],sprague dawley,"['Organotypic hippocampal slices were derived from postnatal day 8 or 9 C57Bl/6 mice pups', 'Seven-day-old Sprague-Dawley rat pups were exposed to 6 h of 0.75% isoflurane']",False,False,False,True,True,True,10.1097/ALN.0b013e31819daedd
+The number of caspase-3–positive neurons in the cortex, thalamus, and hippocampus in each brain slice were counted by an observer blinded to the experimental protocol. Four brain slices were counted per animal. The immunohistochemical and behavioral data are presented as mean ± SD. Statistical analyses was performed by ANOVA followed by post hoc  Newman Keuls testing using the INSTAT (London, United Kingdom) program. P < 0.05 was set as significant.",both,"['Organotypic hippocampal slices were derived from postnatal day 8 or 9 C57Bl/6 mice pups (Harlan Laboratories, Huntingdon, United Kingdom)', 'Seven-day-old Sprague-Dawley rat pups were exposed to 6 h of 0.75% isoflurane in 25% oxygen or air in a temperature-controlled chamber']","postnatal day 7, postnatal day 8","['Organotypic hippocampal slices were derived from postnatal day 8 or 9 C57Bl/6 mice pups', 'Seven-day-old Sprague-Dawley rat pups were exposed to 6 h of 0.75% isoflurane']",Y,['The animals were allowed to mature until postnatal day 40 and then tested for hippocampal-dependent memory and learning function in a previously reported contextual fear-conditioning behavioral paradigm'],isoflurane,['Seven-day-old Sprague-Dawley rat pups were exposed to 6 h of 0.75% isoflurane in 25% oxygen or air in a temperature-controlled chamber'],none,[],sprague dawley,"['Organotypic hippocampal slices were derived from postnatal day 8 or 9 C57Bl/6 mice pups', 'Seven-day-old Sprague-Dawley rat pups were exposed to 6 h of 0.75% isoflurane']",False,False,False,True,True,True,[ Passage 18/25 ] 10.1097/ALN.0b013e31819daedd
 10.18632/oncotarget.15405,1027.0,Li,2017,rats,gestational day 14,Y,ketamine,none,wistar,"PMID: 28430606 PMCID: PMC5464800 DOI: 10.18632/oncotarget.15405
 MATERIALS AND METHODS
 Animals
@@ -529,7 +529,7 @@ WB
 150 μg of protein were separated via 10% SDS-polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane (HybondTM-C Extra, GE Healthcare) via electroblotting. After washing, membranes were blocked with 3% (w/v) BSA (biotopped) for 4 h at room temperature and incubated overnight at 4°C in BSA with antibodies that are specific for Ca2+/Calmodulin-Dependent Protein Kinase II (CaMKII), p-CaMKII, CaMKIV, p-CaMKIV, ERK, p-ERK, PKA, CREB, p-CREB (1.5:1000, EnoGene), p-PKA, and Brain Derived Neurotrophic Factor (BDNF, 1:1000, abcam). Membranes were washed thrice with PBS containing 0.1% Tween and then incubated for 1 h at room temperature either with a horseradish peroxidase-conjugated secondary antibody (Goat anti-Rabbit IgG Antibody HRP (ABIN) or a goat anti-Mouse IgG Antibody HRP (Sigma)) in BSA.
 
 Data analysis
-All data were analyzed with GraphPad Prism 7.0 (GraphPad Software Inc., USA) via one-way ANOVA, followed by Turkey's Post Hoc test or unpaired two-tailed Student t-test. Values were considered to be statistically significant for P < 0.05. Data are presented as means ± standard deviation unless otherwise noted.",rats,"['Male and female Wistar rats, three months of age, weighing 200 ± 20 g, were purchased from the Animal Experimental Center of the Second Affiliated Hospital of the Harbin Medical University (Harbin, China).']",gestational day 14,['The female rats were anesthetized via intravenous ketamine injection (200 mg/Kg) for 3 h on P14 [55].'],Y,"['During B25-B30, Morris water maze task, contextual and cued fear conditioning, and olfactory tasks were used to test learning and memory capacity (n = 120, 5/dam, Figure \u200bFigure11).']",ketamine,['The female rats were anesthetized via intravenous ketamine injection (200 mg/Kg) for 3 h on P14 [55].'],none,[],wistar,"['Male and female Wistar rats, three months of age, weighing 200 ± 20 g, were purchased from the Animal Experimental Center of the Second Affiliated Hospital of the Harbin Medical University (Harbin, China).']",True,True,True,True,True,True,10.18632/oncotarget.15405
+All data were analyzed with GraphPad Prism 7.0 (GraphPad Software Inc., USA) via one-way ANOVA, followed by Turkey's Post Hoc test or unpaired two-tailed Student t-test. Values were considered to be statistically significant for P < 0.05. Data are presented as means ± standard deviation unless otherwise noted.",rats,"['Male and female Wistar rats, three months of age, weighing 200 ± 20 g, were purchased from the Animal Experimental Center of the Second Affiliated Hospital of the Harbin Medical University (Harbin, China).']",gestational day 14,['The female rats were anesthetized via intravenous ketamine injection (200 mg/Kg) for 3 h on P14 [55].'],Y,"['During B25-B30, Morris water maze task, contextual and cued fear conditioning, and olfactory tasks were used to test learning and memory capacity (n = 120, 5/dam, Figure \u200bFigure11).']",ketamine,['The female rats were anesthetized via intravenous ketamine injection (200 mg/Kg) for 3 h on P14 [55].'],none,[],wistar,"['Male and female Wistar rats, three months of age, weighing 200 ± 20 g, were purchased from the Animal Experimental Center of the Second Affiliated Hospital of the Harbin Medical University (Harbin, China).']",True,True,True,True,True,True,[ Passage 19/25 ] 10.18632/oncotarget.15405
 10.1016/j.neulet.2013.04.008,1209.0,Li,2013,rats,postnatal day 7,N,isoflurane,none,sprague dawley,"PMID: 23603260 DOI: 10.1016/j.neulet.2013.04.008
 2. Materials and methods
 All animal procedures were in compliance with the NIH Guide for the Use of Laboratory Animals and approved by the Animal Care and Use Committee of Sun Yat-sen University. Seven-day-old (P7) Sprague-Dawley rat pups (Guangdong Medical Laboratory Animal Co, China) with body weight at 16 ± 3 g were exposed to 1.1% isoflurane (about 0.5 MAC in P7 rats [22]) for 4 h to induce neuronal apoptosis, or to air in a temperature-controlled chamber as we described before [21]. The concentrations of anesthetic gas, oxygen and carbon dioxide (CO2) in the chamber were measured by a gas analyzer (Datex-Ohmeda, Madison, WI).
@@ -540,7 +540,7 @@ For Western blotting studies, rat pups were anaesthetized with isoflurane and th
 
 For TUNEL studies, rat pups were anaesthetized with isoflurane and perfused transcardially with 4% paraformaldehyde. Their brains were paraffin embedded and sectioned at 6 μm thickness. As we described before [19], four or five sections (200 μm apart) for each animal at the same plane of the hippocampus were chosen for detecting apoptosis using TUNEL fluorescent method (Promega, Madision, WI, USA). The slides were protected from direct light during experiment. Hoechst was used to stain nuclei. The TUNEL positive cells in CA1, CA3 and dentate gyrus (DG) areas of hippocampus were analyzed immediately with NIS-Elements BR imaging processing and analysis software (Nikon Corporation, Japan). The densities of the TUNEL positive cells in CA1, CA3 and DG were calculated by dividing the number of TUNEL positive cells by the area of that brain region.
 
-Data are presented in mean ± SEM. The Graphpad Prism 4.0 software was used to conduct the statistical analyses. A two-tailed P value of less than 0.05 was considered statistically significant. One way ANOVA with Newman–Keuls Multiple Comparison Test was used when data was normally distributed and had equal variances. Otherwise, non-parametric test with Dunn's Multiple Comparisons was used to compare the density of TUNEL positive cells as well as the relative protein abundance data among groups in Western blots.",rats,"['Seven-day-old (P7) Sprague-Dawley rat pups (Guangdong Medical Laboratory Animal Co, China) with body weight at 16 ± 3 g were exposed to 1.1% isoflurane']",postnatal day 7,['Seven-day-old (P7) Sprague-Dawley rat pups'],N,['All animal procedures were in compliance with the NIH Guide for the Use of Laboratory Animals and approved by the Animal Care and Use Committee of Sun Yat-sen University.'],isoflurane,['with body weight at 16 ± 3 g were exposed to 1.1% isoflurane'],none,[],sprague dawley,['Seven-day-old (P7) Sprague-Dawley rat pups'],True,True,True,True,True,True,10.1016/j.neulet.2013.04.008
+Data are presented in mean ± SEM. The Graphpad Prism 4.0 software was used to conduct the statistical analyses. A two-tailed P value of less than 0.05 was considered statistically significant. One way ANOVA with Newman–Keuls Multiple Comparison Test was used when data was normally distributed and had equal variances. Otherwise, non-parametric test with Dunn's Multiple Comparisons was used to compare the density of TUNEL positive cells as well as the relative protein abundance data among groups in Western blots.",rats,"['Seven-day-old (P7) Sprague-Dawley rat pups (Guangdong Medical Laboratory Animal Co, China) with body weight at 16 ± 3 g were exposed to 1.1% isoflurane']",postnatal day 7,['Seven-day-old (P7) Sprague-Dawley rat pups'],N,['All animal procedures were in compliance with the NIH Guide for the Use of Laboratory Animals and approved by the Animal Care and Use Committee of Sun Yat-sen University.'],isoflurane,['with body weight at 16 ± 3 g were exposed to 1.1% isoflurane'],none,[],sprague dawley,['Seven-day-old (P7) Sprague-Dawley rat pups'],True,True,True,True,True,True,[ Passage 20/25 ] 10.1016/j.neulet.2013.04.008
 10.1016/j.biopha.2016.01.034,579.0,Lu,2016,rats,postnatal day 7,N,sevoflurane,none,sprague dawley,"PMID: 26898457 DOI: 10.1016/j.biopha.2016.01.034
 2. Materials and methods
 2.1. Animals
@@ -567,7 +567,7 @@ To assess neurodevelopmental outcomes, particularly the learning and memory func
 The passive avoidance test was performed as previously described [26]. The apparatus used for the passive avoidance test included a behavioral stimulation controller and a video shuttle box (Chengdu Instrument Ltd., Chengdu, China). The test relies the natural preference of rats for darkness. Briefly, on the first trial day, the rats were placed in the illuminated compartment after 2 min of habituation to the dark compartment and allowed to re-enter the dark compartment. On the following day, an electric foot shock was delivered through the grid floor of the dark compartment after the rats entered. Twenty-four hours later, the retention of passive avoidance was determined by comparing the time elapsed prior to re-entry into the dark compartment with the arbitrary maximum time of 180 s.
 
 2.6. Statistical analysis
-All data are expressed as the mean ± SEM. SAS 9.2 (SAS Institute Inc., Cary, North Carolina, USA) was used for statistical analysis. One-way ANOVA was used to determine statistically significant differences between the three groups, and Tukey’s post hoc analysis was performed to correct for multiple comparisons when applicable. Statistical significance was accepted as P < 0.05.",rats,"['Because peak anesthesia-induced neurodegeneration in rodents occurs on postnatal day (PND) 7 [22], Sprague-Dawley (SD) PND7 rats weighing 14–18 g, provided by the Animal Center of Shanghai Jiao Tong University School of Medicine (Shanghai, China) were used in this study.']",postnatal day 7,"['Because peak anesthesia-induced neurodegeneration in rodents occurs on postnatal day (PND) 7 [22], Sprague-Dawley (SD) PND7 rats weighing 14–18 g, provided by the Animal Center of Shanghai Jiao Tong University School of Medicine (Shanghai, China) were used in this study.']",Y,"['To assess neurodevelopmental outcomes, particularly the learning and memory functions of juveniles, rats from all groups were subjected to Morris water maze after reaching 6 weeks of age (n = 12), as previously described [24].', 'Finally, to investigate cognitive function during development, the passive avoidance test was performed at 3 months.']",sevoflurane,"['Rats in the other two groups were exposed to either 2% sevoflurane (SEVOFRANE®, Osaka, Japan) for 3 h (Sevo1 group) or 3% sevoflurane for 6 h (Sevo2 group) under 100% oxygen in the same chamber at 37 °C as described previously [13].']",none,[],sprague dawley,"['Because peak anesthesia-induced neurodegeneration in rodents occurs on postnatal day (PND) 7 [22], Sprague-Dawley (SD) PND7 rats weighing 14–18 g, provided by the Animal Center of Shanghai Jiao Tong University School of Medicine (Shanghai, China) were used in this study.']",True,True,False,True,True,True,10.1016/j.biopha.2016.01.034
+All data are expressed as the mean ± SEM. SAS 9.2 (SAS Institute Inc., Cary, North Carolina, USA) was used for statistical analysis. One-way ANOVA was used to determine statistically significant differences between the three groups, and Tukey’s post hoc analysis was performed to correct for multiple comparisons when applicable. Statistical significance was accepted as P < 0.05.",rats,"['Because peak anesthesia-induced neurodegeneration in rodents occurs on postnatal day (PND) 7 [22], Sprague-Dawley (SD) PND7 rats weighing 14–18 g, provided by the Animal Center of Shanghai Jiao Tong University School of Medicine (Shanghai, China) were used in this study.']",postnatal day 7,"['Because peak anesthesia-induced neurodegeneration in rodents occurs on postnatal day (PND) 7 [22], Sprague-Dawley (SD) PND7 rats weighing 14–18 g, provided by the Animal Center of Shanghai Jiao Tong University School of Medicine (Shanghai, China) were used in this study.']",Y,"['To assess neurodevelopmental outcomes, particularly the learning and memory functions of juveniles, rats from all groups were subjected to Morris water maze after reaching 6 weeks of age (n = 12), as previously described [24].', 'Finally, to investigate cognitive function during development, the passive avoidance test was performed at 3 months.']",sevoflurane,"['Rats in the other two groups were exposed to either 2% sevoflurane (SEVOFRANE®, Osaka, Japan) for 3 h (Sevo1 group) or 3% sevoflurane for 6 h (Sevo2 group) under 100% oxygen in the same chamber at 37 °C as described previously [13].']",none,[],sprague dawley,"['Because peak anesthesia-induced neurodegeneration in rodents occurs on postnatal day (PND) 7 [22], Sprague-Dawley (SD) PND7 rats weighing 14–18 g, provided by the Animal Center of Shanghai Jiao Tong University School of Medicine (Shanghai, China) were used in this study.']",True,True,False,True,True,True,[ Passage 21/25 ] 10.1016/j.biopha.2016.01.034
 10.1007/s12035-017-0730-0,230.0,Obradovic,2018,mice,postnatal day 7,N,ketamine,none,cd-1,"PMID: 28840469 PMCID: PMC5808855 DOI: 10.1007/s12035-017-0730-0
 Materials and Methods
 Animals
@@ -590,7 +590,7 @@ Histological Morphometric Assessment
 The morphometric analyses of IBP developmental shortening (from PND10 until PND65 in both control and ketamine-treated mice) were performed using coronal hippocampal slices (50μm) cut from bregma -1.34mm to -2.30mm (as determined using a mouse brain atlas). The images were scanned at 20× magnification using an Aperio Scanscope XT digital slide scanner (Aperio Technologies Inc., Vista, CA) at University of Virginia, Charlottesville, VA and at University of Colorado, Aurora, CO. The hippocampal area in digital sections (.svs file) was extracted at 600μm scale to convert to a .tiff file and was spatially calibrated using 1000 μm2 grid prior to quantifying using Image-Pro Plus 7.0 software (Media Cybernetics, MD). The morphometric approach used to evaluate so called ‘normalized length of IPB’, which takes into consideration individual variability and developmental growth of hippocampus. The IPB length was approximated from the tip of the inferior blade of the dentate granule cell layer (“a”). The length of CA3 was approximated from the tip of the inferior blade to the apex of the curvature of the CA3 pyramidal cell layer (“b”). Normalized IPB length was taken as a ratio between “a” and “b”. The values from serial sections (n=3-6 serial sections per animal from 6-7 animals per age group) were averaged to provide a single data point and is presented as normalized IPB length. The results from different age groups were statistically analyzed by t test and between both groups by Two-way ANOVA using Graph Pad Prism 5.01 software (Graph Pad, CA). The experimenters were blinded to the experimental condition.
 
 Statistical analysis
-Comparisons among groups were made using one-way and two-way ANOVAs followed by Tukey's post hoc test. Using the standard version of GraphPad Prism 5.01 software (Media Cybernetics, Inc, Bethesda, MD), we considered p<0.05 to be statistically significant. All data are presented as mean ±SD or mean ±SEM. The sample sizes reported throughout the Results and in the Figure Legends were based on previous experience.",mice,"['We used 7-day-old (PND7) CD-1 mice (Harlan Laboratories, Indianapolis, IN) for all experiments.']",postnatal day 7,"['We used 7-day-old (PND7) CD-1 mice (Harlan Laboratories, Indianapolis, IN) for all experiments.']",N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",ketamine,"['To achieve general anesthesia state, we used a ketamine protocol known to cause significant developmental neurotoxicity in PND7 mice whereby mouse pups received a total of four doses of ketamine, at 75 mg/kg, IM every 90 minutes so that the loss of righting reflex and lack of response to tail pinch could be maintained for 6 hours [14].']",isoflurane,['Mice were deeply anesthetized with 2% isoflurane and immediately perfused with 4% paraformaldehyde in 0.1 M phosphate buffer (at pH 7.4).'],cd-1,"['We used 7-day-old (PND7) CD-1 mice (Harlan Laboratories, Indianapolis, IN) for all experiments.']",True,True,True,True,False,True,10.1007/s12035-017-0730-0
+Comparisons among groups were made using one-way and two-way ANOVAs followed by Tukey's post hoc test. Using the standard version of GraphPad Prism 5.01 software (Media Cybernetics, Inc, Bethesda, MD), we considered p<0.05 to be statistically significant. All data are presented as mean ±SD or mean ±SEM. The sample sizes reported throughout the Results and in the Figure Legends were based on previous experience.",mice,"['We used 7-day-old (PND7) CD-1 mice (Harlan Laboratories, Indianapolis, IN) for all experiments.']",postnatal day 7,"['We used 7-day-old (PND7) CD-1 mice (Harlan Laboratories, Indianapolis, IN) for all experiments.']",N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",ketamine,"['To achieve general anesthesia state, we used a ketamine protocol known to cause significant developmental neurotoxicity in PND7 mice whereby mouse pups received a total of four doses of ketamine, at 75 mg/kg, IM every 90 minutes so that the loss of righting reflex and lack of response to tail pinch could be maintained for 6 hours [14].']",isoflurane,['Mice were deeply anesthetized with 2% isoflurane and immediately perfused with 4% paraformaldehyde in 0.1 M phosphate buffer (at pH 7.4).'],cd-1,"['We used 7-day-old (PND7) CD-1 mice (Harlan Laboratories, Indianapolis, IN) for all experiments.']",True,True,True,True,False,True,[ Passage 22/25 ] 10.1007/s12035-017-0730-0
 10.1007/s10072-014-1726-4,4902.0,Ren,2014,rats,postnatal day 7,N,isoflurane,none,sprague dawley,"PMID: 24705859 DOI: 10.1007/s10072-014-1726-4
 Methods
 All experimental protocols were approved by the Institutional Animal Care and Use Committee of the University of Virginia (Charlottesville, VA). All surgical and experimental procedures were carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH publications number 80-23) revised in 2011. Efforts were made to minimize the number of animals used and their suffering.
@@ -605,7 +605,7 @@ Brain injury/tissue loss quantification
 After 7 days of the brain HI, rats were sacrificed under deep isoflurane anesthesia and then their brains were harvested as described previously [11, 13]. The hindbrain was removed from cerebral hemispheres and bilateral hemispheres were weighed separately. The weight ratio of left to right hemispheres was calculated.
 
 Statistical analysis
-The results are presented as mean ± SD (n ≥ 6). Statistical analysis was performed by one-way analysis of variance followed by the Tukey’s test. A P ≤ 0.05 was considered statistically significant.",rats,"['Brain HI was performed in 7-day-old male and female Sprague–Dawley rats as described previously [10, 11].']",postnatal day 7,"['Brain HI was performed in 7-day-old male and female Sprague–Dawley rats as described previously [10, 11].']",N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",isoflurane,"['neonates were anesthetized by isoflurane', 'rats were sacrificed under deep isoflurane anesthesia']",sevoflurane,['Sevoflurane postconditioning was performed by exposing neonates to various concentrations of sevoflurane'],sprague dawley,"['Brain HI was performed in 7-day-old male and female Sprague–Dawley rats as described previously [10, 11].']",True,True,True,True,False,True,10.1007/s10072-014-1726-4
+The results are presented as mean ± SD (n ≥ 6). Statistical analysis was performed by one-way analysis of variance followed by the Tukey’s test. A P ≤ 0.05 was considered statistically significant.",rats,"['Brain HI was performed in 7-day-old male and female Sprague–Dawley rats as described previously [10, 11].']",postnatal day 7,"['Brain HI was performed in 7-day-old male and female Sprague–Dawley rats as described previously [10, 11].']",N,"[""The document does not mention any behavior tests such as 'Open field test', 'Morris water task', 'fear conditioning test', 'Dark/light avoidance'; 'passive/active avoidance test'; 'elevated maze', 'Forced swim test', 'Object recognition test', 'Social interaction/preference'.""]",isoflurane,"['neonates were anesthetized by isoflurane', 'rats were sacrificed under deep isoflurane anesthesia']",sevoflurane,['Sevoflurane postconditioning was performed by exposing neonates to various concentrations of sevoflurane'],sprague dawley,"['Brain HI was performed in 7-day-old male and female Sprague–Dawley rats as described previously [10, 11].']",True,True,True,True,False,True,[ Passage 23/25 ] 10.1007/s10072-014-1726-4
 10.1097/ALN.0000435846.28299.e7,1054.0,Takaenoki,2014,mice,postnatal day 6,Y,sevoflurane,none,c57bl/6,"PMID: 24061597 DOI: 10.1097/ALN.0000435846.28299.e7
 Materials and Methods
 Animals
@@ -658,7 +658,7 @@ Olfactory Test
 The olfactory test was conducted as described previously.3 
 
 Statistical Analysis
-Statistical analysis was performed using GraphPad Prism 5 (GraphPad Software Inc., La Jolla, CA). Comparisons of the means of each group were performed using Student t test, one-way ANOVA followed by Bonferroni post hoc test, and two-way ANOVA followed by Bonferroni post hoc test. Comparisons of the survival rate until P6 were performed using a log-rank (Mantel-Cox) test. We did not exclude any data in this study. P values of less than 0.05 were considered statistically significant. Values are presented as the mean ± SEM in bar graphs.",mice,['Inbred C57BL/6 mice were used in this study and maintained as described previously.5'],postnatal day 6,"['Sevoflurane anesthesia was carried out as described previously.5  In brief, on postnatal day 6 (P6), pups were placed in a humid chamber immediately after removal of mice from the maternal cage.']",N,"['Behavioral studies: control, sevoflurane, and sevoflurane + hydrogen groups (n = 10–11 dams for each group); the primary outcome measure was latencies for pup retrieval; in the pup retrieval test, a minimum biologically important difference was set at a 30% increase from the baseline level in the control group.']",sevoflurane,['Sevoflurane anesthesia was carried out as described previously.5'],none,[],c57bl/6,['Inbred C57BL/6 mice were used in this study and maintained as described previously.5'],True,True,False,True,True,True,10.1097/ALN.0000435846.28299.e7
+Statistical analysis was performed using GraphPad Prism 5 (GraphPad Software Inc., La Jolla, CA). Comparisons of the means of each group were performed using Student t test, one-way ANOVA followed by Bonferroni post hoc test, and two-way ANOVA followed by Bonferroni post hoc test. Comparisons of the survival rate until P6 were performed using a log-rank (Mantel-Cox) test. We did not exclude any data in this study. P values of less than 0.05 were considered statistically significant. Values are presented as the mean ± SEM in bar graphs.",mice,['Inbred C57BL/6 mice were used in this study and maintained as described previously.5'],postnatal day 6,"['Sevoflurane anesthesia was carried out as described previously.5  In brief, on postnatal day 6 (P6), pups were placed in a humid chamber immediately after removal of mice from the maternal cage.']",N,"['Behavioral studies: control, sevoflurane, and sevoflurane + hydrogen groups (n = 10–11 dams for each group); the primary outcome measure was latencies for pup retrieval; in the pup retrieval test, a minimum biologically important difference was set at a 30% increase from the baseline level in the control group.']",sevoflurane,['Sevoflurane anesthesia was carried out as described previously.5'],none,[],c57bl/6,['Inbred C57BL/6 mice were used in this study and maintained as described previously.5'],True,True,False,True,True,True,[ Passage 24/25 ] 10.1097/ALN.0000435846.28299.e7
 10.1097/01.anes.0000291447.21046.4d,845.0,Zhao,2007,rats,postnatal day 6,Y,isoflurane,none,sprague dawley,"PMID: 18043065 DOI: 10.1097/01.anes.0000291447.21046.4d
 Materials and Methods
 The animal protocol was approved by the institutional Animal Care and Use Committee of the University of Virginia, Charlottesville, Virginia. All animal experiments were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (  National Institutes of Health publication No. 80-23) revised in 1996. All reagents unless specified below were obtained from Sigma Chemical (St. Louis, MO).
@@ -693,4 +693,4 @@ Our previous study showed that a 2-h left hemisphere hypoxia–ischemia reduced
 
 Data are presented as mean ± SD. Results of hippocampal and cortical area ratio, neuronal density ratio, speed–latency index, percentage of alternation, and the ratio of the investigation times of the different study groups were compared by one-way analysis of variance (ANOVA) followed by the Student-Newman-Keuls (SNK) method or by one-way ANOVA on ranks followed by the Dunn method as appropriate. The Western blot data were analyzed by one-way ANOVA on ranks followed by the Dunn method. The mortality rates among groups were analyzed by Z  test. The comparison of body weight among groups was performed by ANOVA for repeated measures followed by the SNK method. P < 0.05 was considered significant. All statistical analyses were performed with SigmaStat (Systat Software, Inc., Point Richmond, CA).
 
-Results",rats,['7-day-old male and female Sprague-Dawley rats were anesthetized by isoflurane'],postnatal day 6,['Six-day-old rats were placed in a chamber containing 1.5% isoflurane'],Y,"['Motor Coordination Evaluation', 'Y Maze and Social Recognition']",isoflurane,['Six-day-old rats were placed in a chamber containing 1.5% isoflurane'],none,[],sprague dawley,['7-day-old male and female Sprague-Dawley rats were anesthetized by isoflurane'],True,True,True,True,True,True,10.1097/01.anes.0000291447.21046.4d
+Results",rats,['7-day-old male and female Sprague-Dawley rats were anesthetized by isoflurane'],postnatal day 6,['Six-day-old rats were placed in a chamber containing 1.5% isoflurane'],Y,"['Motor Coordination Evaluation', 'Y Maze and Social Recognition']",isoflurane,['Six-day-old rats were placed in a chamber containing 1.5% isoflurane'],none,[],sprague dawley,['7-day-old male and female Sprague-Dawley rats were anesthetized by isoflurane'],True,True,True,True,True,True,[ Passage 25/25 ] 10.1097/01.anes.0000291447.21046.4d