BacteriaTIS-DNABERT-K6-89M
This model, BacteriaTIS-DNABERT-K6-89M
, is a DNA sequence classifier based on DNABERT trained for Translation Initiation Site (TIS) classification in bacterial genomes. It operates on 6-mer tokenized sequences derived from a 60 bp window (30 bp upstream + 30 bp downstream) around the TIS. The model was fine-tuned using 89M trainable parameters.
Model Details
- Base Model: DNABERT
- Task: Translation Initiation Site (TIS) Classification
- K-mer Size: 6
- Input Sequence Window: 60 bp (30 upstream + 30 downstream) of TIS site in ORF sequence
- Number of Trainable Parameters: 89M
- Max Sequence Length: 512
- Precision Used: AMP (Automatic Mixed Precision)
Install Dependencies
Ensure you have transformers
and torch
installed:
pip install torch transformers
Load Model & Tokenizer
import torch
from transformers import AutoModelForSequenceClassification, AutoTokenizer
# Load Model
model_checkpoint = "Genereux-akotenou/BacteriaTIS-DNABERT-K6-89M"
model = AutoModelForSequenceClassification.from_pretrained(model_checkpoint)
tokenizer = AutoTokenizer.from_pretrained(model_checkpoint)
Inference Example
To classify a TIS, extract a 60 bp sequence window (30 bp upstream + 30 bp downstream) of the TIS codon site and convert it to 6-mers:
def generate_kmer(sequence: str, k: int, overlap: int = 1):
"""Generate k-mer encoding from DNA sequence."""
return " ".join([sequence[j:j+k] for j in range(0, len(sequence) - k + 1, overlap)])
# Example TIS-centered sequence (60 bp window)
sequence = "AGAACCAGCCGGAGACCTCCTGCTCGTACATGAAAGGCTCGAGCAGCCGGGCGAGGGCGG"
seq_kmer = generate_kmer(sequence, k=6)
Run Model
# Tokenize input
inputs = tokenizer(
seq_kmer,
return_tensors="pt",
max_length=tokenizer.model_max_length,
padding="max_length",
truncation=True
)
# Run inference
with torch.no_grad():
outputs = model(**inputs)
logits = outputs.logits
predicted_class = torch.argmax(logits, dim=-1).item()
- Downloads last month
- 16
Inference Providers
NEW
This model isn't deployed by any Inference Provider.
🙋
Ask for provider support