Datasets:
beyoru
/
FC_bench_800_base

Dataset card Data Studio Files Community
1
question
stringlengths
20
220
functions
stringlengths
2
2.27k
Find a pet store near Los Angeles, CA
[{"name": "grocery_store.locate_nearby", "description": "Find grocery stores nearby a specific location.", "parameters": {"type": "object", "properties": {"location": {"type": "string", "description": "The city and state, e.g., Los Angeles, CA"}, "store_type": {"type": "array", "items": {"type": "string", "enum": ["Supermarket", "Convenience Store", "Discount Store"]}, "description": "Type of the grocery store.", "default": ["Supermarket"]}, "is_24_hours": {"type": "boolean", "description": "Whether the grocery store is open 24 hours.", "default": "True"}}, "required": ["location"]}}]
What's the population in New York right now?
[{"name": "time_converter", "description": "Converts the local time of user's region to the target region's local time.", "parameters": {"type": "object", "properties": {"user_timezone": {"type": "string", "description": "The timezone of the user in string format. Example: 'Pacific Time (US & Canada)'"}, "target_timezone": {"type": "string", "description": "The target timezone in string format where user wants to know the local time. Example: 'Eastern Time (US & Canada)'"}, "time": {"type": "string", "description": "The local time of user's timezone in string format (24 hr format). Optional parameter. Example: '15:30:00'", "default": "13:30:00"}}, "required": ["user_timezone", "target_timezone"]}}]
What's timezone is it in London?
[{"name": "get_local_time", "description": "Retrieve the current local time in a specified time zone.", "parameters": {"type": "object", "properties": {"timezone": {"type": "string", "description": "The timezone for which local time needs to be calculated."}, "date_format": {"type": "string", "description": "The format in which the date and time should be returned. Default is 'YYYY-MM-DD HH:mm:ss'."}}, "required": ["timezone", "date_format"]}}]
When will be sunset in Beijing today?
[{"name": "calculate_sunrise", "description": "Calculate the time of sunrise for a specific date and location.", "parameters": {"type": "object", "properties": {"location": {"type": "string", "description": "The location for which sunrise time needs to be calculated."}, "date": {"type": "string", "description": "The date for which sunrise time needs to be calculated in YYYY-MM-DD format. If not provided, current date is considered. Default: 1998-12-03"}, "format": {"type": "string", "description": "Format in which the time should be returned. If not provided, default format 'HH:MM' is considered."}}, "required": ["location"]}}]
What is the current time in Sydney, Australia?
[{"name": "get_local_time", "description": "Retrieve the local time for a specific city.", "parameters": {"type": "object", "properties": {"location": {"type": "string", "description": "The city to get the local time for."}, "format": {"type": "string", "description": "The format of the time to be retrieved, either 12 hours or 24 hours.", "enum": ["12", "24"], "default": "12"}, "timezone": {"type": "string", "description": "The timezone of the location. If left blank, the function will default to the city's local timezone."}}, "required": ["location"]}}]
What are some popular sushi restaurants in Tokyo?
[{"name": "book_hotel", "description": "Book a hotel room in a specified location for certain dates.", "parameters": {"type": "object", "properties": {"location": {"type": "string", "description": "The city where the hotel is located."}, "check_in_date": {"type": "string", "description": "The date when the guest will check into the hotel."}, "check_out_date": {"type": "string", "description": "The date when the guest will check out from the hotel."}, "room_type": {"type": "string", "optional": true, "description": "The type of room the guest would prefer. Default: 'double'"}}, "required": ["location", "check_in_date", "check_out_date"]}}]
Find a Thai restaurant in Chicago with vegetarian options.
[{"name": "hotel_booking.check_availability", "description": "Check room availability in a hotel based on certain criteria such as location and dates.", "parameters": {"type": "object", "properties": {"hotel_name": {"type": "string", "description": "The name of the hotel."}, "location": {"type": "string", "description": "The city where the hotel is located."}, "check_in_date": {"type": "string", "description": "The check-in date."}, "check_out_date": {"type": "string", "description": "The check-out date."}, "room_type": {"type": "string", "description": "The type of room.", "default": "double"}}, "required": ["hotel_name", "location", "check_in_date", "check_out_date"]}}]
Find a hotel in New York that provides breakfast and has a fitness centre.
[{"name": "hotel_search.find_hotels", "description": "Search for hotels based on location and amenities.", "parameters": {"type": "object", "properties": {"location": {"type": "string", "description": "The city and state, e.g. New York, NY."}, "amenities": {"type": "array", "items": {"type": "string", "enum": ["Breakfast", "Fitness Centre", "Free Wi-Fi", "Parking"]}, "description": "Preferred amenities in the hotel."}}, "required": ["location", "amenities"]}}]
What is the equivalent of $20 in British Pounds?
[{"name": "weather_in_location", "description": "Retrieve the current weather conditions in a specific location.", "parameters": {"type": "object", "properties": {"location": {"type": "string", "description": "The location where to retrieve the weather conditions."}, "unit": {"type": "string", "enum": ["C", "F"], "description": "The unit to use for the temperature, either Celsius (C) or Fahrenheit (F)."}}, "required": ["location", "unit"]}}]
What is the quickest way to get to Tokyo from London by plane?
[{"name": "get_flight_duration", "description": "Retrieves the quickest flight duration between two cities.", "parameters": {"type": "object", "properties": {"start_city": {"type": "string", "description": "The city you are starting your journey from."}, "destination_city": {"type": "string", "description": "The city you wish to travel to."}, "flight_type": {"type": "string", "description": "The type of flight you want to find duration for. Choices include: non-stop, direct, and multi-stop."}}, "required": ["start_city", "destination_city", "flight_type"]}}]
Where is the nearest pharmacy in Los Angeles?
[{"name": "get_route_to_location", "description": "Calculates a route to a specified location based on the starting point and desired method of transportation.", "parameters": {"type": "object", "properties": {"start_point": {"type": "string", "description": "The starting location for the route."}, "end_point": {"type": "string", "description": "The desired destination of the route."}, "transport_method": {"type": "string", "description": "The method of transportation. Options include 'Driving', 'Walking', 'Cycling', and 'Public Transport'", "default": "Driving"}}, "required": ["start_point", "end_point"]}}]
Find the distance in kilometers from San Francisco to Los Angeles.
[{"name": "get_date", "description": "Get the time difference between two geographical locations.", "parameters": {"type": "object", "properties": {"location_1": {"type": "string", "description": "location for first city."}, "location_2": {"type": "string", "description": "location for first city."}, "unit": {"type": "string", "enum": ["miles", "kilometers"], "description": "The unit of measure for the distance. Default is miles."}}, "required": ["location_1", "location_2"]}}]
Find the area of a triangle with a base of 10 units and height of 5 units.
[]
Calculate the factorial of 5 using math functions.
[]
Calculate the hypotenuse of a right triangle given the lengths of the other two sides as 4 and 5.
[]
Find the roots of a quadratic equation with coefficients a=1, b=-3, c=2.
[]
Solve a quadratic equation where a=2, b=6, and c=5
[]
Find the roots of a quadratic equation given coefficients a = 3, b = -11, and c = -4.
[]
What are the roots of the quadratic equation where a=2, b=5 and c=3 ?
[]
What is the circumference of a circle with a radius of 4 inches?
[]
What's the area of a circle with a radius of 10?
[]
Calculate the area of a circle with a radius of 5 units.
[]
Calculate the area of a right-angled triangle given the lengths of its base and height as 6cm and 10cm.
[]
What is the area of a triangle with base of 10 units and height of 5 units?
[]
Calculate the circumference of a circle with radius 3
[]
Calculate the area under the curve y=x^2 from x=1 to x=3.
[]
Calculate the derivative of the function 3x^2 + 2x - 1.
[]
Calculate the area under the curve from x = -2 to x = 3 for the function y = x^3 using simpson method.
[]
Calculate the derivative of the function 2x^2 at x = 1.
[]
Find the prime factors of 450
[]
Find the prime factors of the number 123456.
[]
Calculate the greatest common divisor of two numbers: 40 and 50
[]
Find the highest common factor of 36 and 24.
[]
Find the Greatest Common Divisor (GCD) of two numbers, say 36 and 48.
[]
Calculate the greatest common divisor of two given numbers, for example 12 and 15.
[]
What is the prime factorization of the number 60? Return them in the form of dictionary
[]
Find the greatest common divisor (GCD) of 12 and 18
[]
Calculate the final velocity of an object falling from a 150 meter building, assuming initial velocity is zero.
[]
Calculate the velocity of a car that travels a distance of 50 kilometers for a duration of 2 hours?
[]
Calculate the final velocity of a vehicle after accelerating at 2 meters/second^2 for a duration of 5 seconds, starting from a speed of 10 meters/second.
[]
Calculate the displacement of a car given the initial velocity of 10 and acceleeration of 9.8 within 5 seconds.
[]
What is the final speed of an object dropped from rest after falling for 5 seconds if we neglect air resistance?
[]
What is the final velocity of a vehicle that started from rest and accelerated at 4 m/s^2 for a distance of 300 meters?
[]
Calculate the final velocity of an object, knowing that it started from rest, accelerated at a rate of 9.8 m/s^2 for a duration of 5 seconds.
[]
Calculate the final speed of an object dropped from 100 m without air resistance.
[]
Get directions from Sydney to Melbourne using the fastest route.
[]
Create an itinerary for a 7 days trip to Tokyo with daily budgets not exceeding $100 and prefer exploring nature.
[]
Find an all vegan restaurant in New York that opens until at least 11 PM.
[]
Find the shortest driving distance between New York City and Washington D.C.
[]
Find the estimated travel time by car from San Francisco to Los Angeles with stops at Santa Barbara and Monterey.
[]
What is the electrostatic potential between two charged bodies of 1e-9 and 2e-9 of distance 0.05?
[]
Calculate the electric field at a point 3 meters away from a charge of 2 coulombs.
[]
Calculate the magnetic field produced at the center of a circular loop carrying current of 5 Ampere with a radius of 4 meters
[]
Calculate the electromagnetic force between two charges of 5C and 7C placed 3 meters apart.
[]
Calculate the resonant frequency of an LC circuit given capacitance of 100µF and inductance of 50mH.
[]
Calculate the magnetic field strength 10 meters away from a long wire carrying a current of 20 Amperes.
[]
Calculate the electric field strength 4 meters away from a charge of 0.01 Coulombs.
[]
Calculate the energy (in Joules) absorbed or released during the phase change of 100g of water from liquid to steam at its boiling point.
[]
Calculate the final temperature when 20 kg of water at 30 degree Celsius is mixed with 15 kg of water at 60 degree Celsius.
[]
Find the boiling point and melting point of water under the sea level of 5000m.
[]
What is the density of a substance with a mass of 45 kg and a volume of 15 m³?
[]
Calculate the absolute pressure in pascals given atmospheric pressure of 1 atm and a gauge pressure of 2 atm.
[]
What is the change in entropy in Joules per Kelvin of a 1kg ice block at 0°C if it is heated to 100°C under 1 atmosphere of pressure?
[]
Calculate the entropy change for a certain process given an initial temperature of 300K, a final temperature of 400K, and a heat capacity of 5J/K.
[]
Calculate the heat capacity at constant pressure for air, given its temperature is 298K and volume is 10 m^3.
[]
Retrieve the sequence of DNA molecule with id `DNA123`.
[]
Identify the protein sequence of a given human gene 'BRCA1'.
[]
Find me detailed information about the structure of human cell
[]
What are the names of proteins found in the plasma membrane?
[]
Calculate the cell density in a sample with an optical density of 0.6, where the experiment dilution is 5 times.
[]
What is the function of ATP synthase in mitochondria?
[]
Calculate the molecular weight of Glucose (C6H12O6).
[]
Find the type of gene mutation based on SNP (Single Nucleotide Polymorphism) ID rs6034464.
[]
Predict whether a person with weight 150lbs and height 5ft 10in who is lightly active will get type 2 diabetes.
[]
Analyze the DNA sequence 'AGTCGATCGAACGTACGTACG' for any potential substitution mutations based on a reference sequence 'AGTCCATCGAACGTACGTACG'.
[]
Find out how genetically similar a human and a chimp are in percentage.
[]
What is the genotype frequency of AA genotype in a population, given that allele frequency of A is 0.3?
[]
Calculate the Population Density for Brazil in 2022 if the population is 213 million and the land area is 8.5 million square kilometers.
[]
Get me data on average precipitation in the Amazon rainforest for the last six months.
[]
Identify a small green bird in forest.
[]
Predict the growth of forest in Yellowstone National Park for the next 5 years including human impact.
[]
Find out the population and species of turtles in Mississippi river in 2020.
[]
What is the carbon footprint of a gas-powered vehicle driving 1500 miles in a year?
[]
Generate a DNA sequence with 100 bases including more G (Guanine) and C (Cytosine).
[]
Calculate the expected evolutionary fitness of a creature, with trait A contributing to 40% of the fitness and trait B contributing 60%, if trait A has a value of 0.8 and trait B a value of 0.7.
[]
What's the projected population growth in United States in the next 20 years?
[]
Calculate the evolution rate of a bacteria population, start with 5000 bacteria, each bacteria duplicates every hour for 6 hours.
[]
Estimate the population size of elephants of 35000 in the next 5 years given the current growth rate of 0.015.
[]
Get me the predictions of the evolutionary rate for Homo Sapiens for next 50 years using Darwin model
[]
Find a nearby restaurant that serves vegan food in Los Angeles.
[]
Get the average temperature in Austin for the next 3 days in Celsius.
[]
Create a histogram for student scores with the following data: 85, 90, 88, 92, 86, 89, 91 and set bin range to 5.
[]
I want to find 5 restaurants nearby my location, Manhattan, offering Thai food and a vegan menu.
[]
Find the fastest route from San Francisco to Los Angeles with toll roads avoided.
[]
Calculate the average of list of integers [12, 15, 18, 20, 21, 26, 30].
[]
Calculate the distance between two GPS coordinates (33.4484 N, 112.0740 W) and (34.0522 N, 118.2437 W) in miles.
[]
Calculate the Body Mass Index (BMI) of a person with a weight of 85 kilograms and height of 180 cm.
[]
What's the approximate distance between Boston, MA, and Washington, D.C. in mile?
[]
Find the shortest distance between two cities, New York and Los Angeles, through the train and you can transfer.
[]
Sort the list [5, 3, 4, 1, 2] in ascending order.
[]