videoID
stringclasses 211
values | question_id
int64 0
1.46k
| category
stringclasses 14
values | question
stringlengths 20
313
| options
listlengths 5
5
| answer
stringclasses 5
values | steps
stringlengths 98
2.44k
| length
stringclasses 3
values |
---|---|---|---|---|---|---|---|
1QiiEPNv9wM
| 310 |
Board Games
|
What does the host do with his left hand at 07:42?
|
[
"A. Gives a high five.",
"B. Reaches across the table.",
"C. Waves it around.",
"D. Slaps a card on the table.",
"E. Snaps his fingers."
] |
B
|
I watched the video and saw a player tease the host at 05:32. After that, the host played another card, and then he held up his middle finger to the player that was teasing him.
|
short
|
1QiiEPNv9wM
| 311 |
Board Games
|
What color is the first hat of the card player with a role on the television series The Flash?
|
[
"A. Green.",
"B. Gray.",
"C. Beige.",
"D. Brown.",
"E. Red."
] |
B
|
At 00:15-00:17, I watched the video display title cards indicating the names of Matt, the card player in the checkered shirt, and Patrick. I saw that Patrick has a fully grown, stubbly beard and dark gray hat. From 00:34-00:36, I watched Matt turn out to the audience, gesturing with his right hand toward his seated neighbor. I also listened to Matt state that Patrick was on the show titled The Flash at 00:35-00:36 state that Patrick was on the show titled The Flash at 00:35-00:36 - thus, the person with the role on The Flash is wearing a gray hat.
|
medium
|
1QiiEPNv9wM
| 312 |
Board Games
|
On the card that shows writing on the back of the hand, which numbered instruction deals with Reducing Party Interest?
|
[
"A. 3.",
"B. 5.",
"C. 1.",
"D. 2.",
"E. 4."
] |
E
|
I watched the video until 01:48, when the card with writing on the back of the hand was clearly shown. I read the instructions on the back of this card, determining from my reading that the instructions labeled (4) on the list dealt with reducing party interest.
|
medium
|
1QiiEPNv9wM
| 313 |
Board Games
|
How many times does the host look at the audience from 12:00-13:00?
|
[
"A. 1.",
"B. 3.",
"C. 4.",
"D. 5.",
"E. 6."
] |
B
|
I watched the video during the specified timespan, and counted the number of times I saw the host look out to the audience, which is out of the left of the frame relative to the camera that films the host. I determined this by the responsiveness of the audience when the host looked out in that direction, such as at 12:21. I noted that the host looked out of the left of the frame and received an audience response from 12:20-12:23, the second time he looked out was a quick glance from 12:38-12:39, and the third time from 12:45-12:51, for a total of three times in this span.
|
medium
|
1QiiEPNv9wM
| 314 |
Board Games
|
What word is written directly below the caricature on the first conversation card played?
|
[
"A. Awkward.",
"B. Card.",
"C. Conversation.",
"D. Tornado.",
"E. Weather."
] |
E
|
I watched the video through the moment the lead host in the striped brown shirt finishes explaining the rules of the game, "Awkward Party", from 00:00-03:08. At 03:09, I listened to the card player in the black tee shirt read his card aloud, and I watched him display his chosen card, labeled Conversation Card, on the table. From 03:09-03:10, I watched the card player in the black tee shirt read the card aloud as the Conversation Card is revealed to have a caricature of a spiky haired man grabbing his friend and shouting in a text bubble, "Oh F***!!!! A Tornado!!!". Below the caricature reads "Weather".
|
medium
|
1QiiEPNv9wM
| 315 |
Board Games
|
What does the card on the left have written on it at 11:49?
|
[
"A. Teaching wizards how to code.",
"B. Neville Longbottom, that's who.",
"C. The entire Gryffindor Quidditch team.",
"D. is going to Azkaban for.",
"E. Due to Dementors deserting Azkaban, it will now be guarded by."
] |
C
|
I watched the video and saw the second game they play is Cards Against Muggles. During this game, I saw the cards that were shown at 11:49, and I read the card on the left. It said, "The entire Gryffindor Quidditch team".
|
medium
|
1QiiEPNv9wM
| 316 |
Board Games
|
Besides the maple leaf, what is a prominent feature of the Canadian hat that the first man in the "Surplus of Popes" t-shirt wears?
|
[
"A. A hockey stick design.",
"B. A pair of moose antlers.",
"C. A giant bow.",
"D. A Mountie logo.",
"E. A beaver tail."
] |
B
|
I watched the video from 02:17, when the card player in the gray shirt lifts a plastic bag from his lap, extracting a variety of red and white hats. Throughout, I listened to the card player in the brown checkered shirt that explains to the audience that these are "Canadian hats". From 02:27-02:37, the quartet of card players don their respective hats, each emblazoned with a logo of Canada's flag and corresponding red maple leaf. At 02:30, I identified that the hat donned by the man wearing the t-shirt which read "Surplus of Popes" had prominent red moose antlers on the sides.
|
medium
|
1jzROE6EhxM
| 317 |
Tech/AI
|
From 04:30 to 05:30, how many times does the blue symbols for Wi-Fi appear?
|
[
"A. 3.",
"B. 5.",
"C. 8.",
"D. 2.",
"E. 6."
] |
D
|
I listened to the narrator discuss "proof of history" at 04:33. At 04:38, I saw the first blue Wi-Fi symbol appear at the top left. I identified the symbol as a Wi-Fi symbol because the symbol consists of three curved lines that extend from a single point, plus a dot. From 04:39 to 04:41, I saw two gray Wi-Fi symbols appear. At 05:05, I see one blue and two gray Wi-Fi symbols appear. I counted a total of 6 Wi-Fi symbols, of which only 2 were blue.
|
medium
|
1jzROE6EhxM
| 318 |
Tech/AI
|
How many green blocks connected with Solana appear in the first 4 minutes of the video?
|
[
"A. 9",
"B. 3",
"C. 4",
"D. 1",
"E. 5"
] |
C
|
I saw 1 green block at 01:20, and at the same time heard the narrator talk about Solana's block time, so I decided to count this one. I then saw 5 green blocks at 02:50, but when I listened to the narrator speak at that time, he was only talking about computers trying to figure out the time. At 03:13, I saw some blocks change color, and 3 of them became green. At the same time, I heard the narrator say that "Solana fixes this" -- he was referring to the problem that other digital currencies have on agreeing as to what time it is. I decided that these blocks were changing color on account of Solana, so I counted those too. I discounted the 5 green blocks from 02:50, and added up the 1 green block from 01:20 and the 3 green blocks from 03:13 and got a total of 4. Those 4 were all the green blocks I saw in the first 4 minutes in the video.
|
long
|
1jzROE6EhxM
| 319 |
Tech/AI
|
How many envelopes have arrows on them during the “famous whiteboard crypto story” in total?
|
[
"A. 4",
"B. 2.",
"C. 0.",
"D. 8.",
"E. 6."
] |
B
|
I begin watching the video looking and listening for the narrator to tell the "famous whiteboard story." At 03:32 the narrator begins using one of the "famous whiteboard crypto stories." At 03:37, I see one envelope appear on screen, an arrow appears on the envelope at 03:38. At 03:42-03:43 a second envelope appears with an arrow on it. At 3:45, two envelopes appear, they have no arrow on them. Between 04:22 and 04:25 4 more envelopes appear with no arrow on them. I continue to watch looking for any envelopes with arrows on them until the end of the story at 05:12 and no more envelopes appear. I counted a total of two envelopes with arrows on them.
|
medium
|
1jzROE6EhxM
| 320 |
Tech/AI
|
What company is mentioned just after a light bulb appears on someone's head?
|
[
"A. Visa.",
"B. Coinbase.",
"C. Nvidia.",
"D. Solana.",
"E. Qualcomm."
] |
E
|
At 01:04, I saw the word, Qualcomm appear. Right before that at 01:02, I listened to the narrator describe Anatoly Yakavenko as "smart." At the same time, I saw a yellow lightbulb appear on top of the head. I identified the yellow object as a light bulb due to the presence of the glass bulb, filament, and the electrical contact (foot).
|
medium
|
1jzROE6EhxM
| 321 |
Tech/AI
|
In the section, "Anyone can stake", the number 100,000 appears on screen. What number would be on the other side of the equal sign if 100,000 was replaced with 215,000?
|
[
"A. 100.",
"B. 68.8.",
"C. 47.2",
"D. 215.",
"E. 32."
] |
B
|
I begin watching the video looking and listening for the section "Anyone can stake" and the number 100,000. At 05:17, I see the words "Anyone can stake" appear on the screen and the narrator begins discussing Proof of Stake. At 05:35, I see the number 100,000 appear on the screen as part of the equation, 32 ethereum = $100,000. I then perform calculations to determine how many ethereum there will be when the cost is $215,000. First I find the value of 1 etherum by dividing 100,000 / 32 = $3,125 = 1 ethereum. Next, to find out how many ethereum equal $215,000, I divide 215,000 / 3125 = 68.8 Ethereum.
|
medium
|
1jzROE6EhxM
| 322 |
Tech/AI
|
At 05:58, when the narrator is discussing SeaLevel, he describes a human performing serial tasks. The human sweeping is wearing the same color shirt as someone when he was telling the “famous whiteboard crypto story”. Who is wearing the same color shirt as this human?
|
[
"A. Your aunt.",
"B. Your cousin.",
"C. Your grandma.",
"D. Your uncle.",
"E. Your grandpa."
] |
C
|
I began watching the video at 05:58 looking and listening for the human performing serial tasks. At 06:16, I see a human appear on screen holding a broom and wearing a blue shirt. I then go back earlier in the video to 03:32 when the narrator is telling the famous whiteboard crypto story. At 04:00, the narrator says "your uncle" and I see an arrow extending from a human wearing a grey shirt indicating this is your uncle. At 04:03 the narrator says "your aunt" and I see an arrow extending from a human wearing a pink shirt indicating this is your Aunt. At 04:05, the narrator says "your cousin" and I see an arrow extending from a human-like figure wearing a yellow shirt. At 04:08, I hear the narrator say "your grandma" and I see a human-like figure wearing a blue shirt appear on screen.
|
medium
|
1jzROE6EhxM
| 323 |
Tech/AI
|
How many transactions does Visa have in one day?
|
[
"A. 2,044,742,400.",
"B. 14,313,196,800.",
"C. 744,286,233,600.",
"D. 85,197,600.",
"E. 23,666."
] |
A
|
At 1:39, I saw "23666 transactions/sec" written underneath the image of the Visa card. I then calculated the number of Visa transactions per day. To find how many seconds are in a day, I started by finding how many seconds are in an hour. I multiplied 60 by 60 to get 3,600 seconds in an hour. I then multiplied 3,600 by 24 to find that there are 86,400 seconds in a day. I then multiplied 23,666 (transactions) by 86,400 (seconds) to find that there are 2,044,742,400 Visa transactions in one day.
|
medium
|
1jzROE6EhxM
| 324 |
Tech/AI
|
In the video a visa card appears with a numbers undeneath. If this number were increased by 10000, how much faster would Solana’s transaction speed be than Visa's?
|
[
"A. 2109 times faster.",
"B. 210.9 times faster.",
"C. 21.09 times faster.",
"D. 2.19 times faster.",
"E. 21.90 times faster."
] |
C
|
I begin watching the video looking for a visa card that appears with a number of transactions per second. At 01:35 I hear the narrator say that Solana's transaction speed is up to 710,000 per second around 30 times faster than Visa. At 01:41, I see a visa card appear on screen with 23666 transactions/sec written underneath. I also see a Computer screen with a label for Solana and that Solana's transaction per second is 710,000. I perform the calculations to determine how much faster Solana's transaction speed would be if the number of transactions by visa were increased by 10000. I add 10000 to 23666 to get 33666. I then divide 710,000 by 33,666 and I get 21.09. Solana's transaction speed would be 21.09 times faster.
|
medium
|
1jzROE6EhxM
| 325 |
Tech/AI
|
When the narrator says "Proof of history" for the fourth time in the video, how many yellow blocks appear on screen?
|
[
"A. 4",
"B. 3",
"C. 1",
"D. 2",
"E. 5"
] |
D
|
I watched the video and listened for instances when the narrator says, "proof of history." At 00:19, the narrator says "proof of history" for the first time. At 02:17, the narrator says "proof of history" for the second time. At 02:24, I hear the narrator say "proof of history" for the third time. At 03:14, I hear the narrator say proof of history for the fourth time. At 03:14, there are several colored blocks on screen, and at the bottom right, there are 2 yellow boxes.
|
medium
|
2SdMmx_sLNc
| 326 |
How-To
|
If the viewer were to do the seated hamstring stretch for the recommended amount of time with a 10 second rest in between each set, how much time total would they spend on the stretch routine?
|
[
"A. 150 seconds",
"B. 120 seconds",
"C. 140 seconds",
"D. 180 seconds",
"E. 170 seconds"
] |
E
|
I watched the video in order to figure out where the seated hamstring stretch was shown at. I found that section at 03:59 when a graphic appeared on the screen that has a title "Seated Hamstring Stretch". The trainer then demonstrates that stretch and a graphic pops up at 05:09 that says "20 seconds hold" and "3 sets (each side)." 3 sets on each side would equal 6 total sets of 20 seconds each. 6 times 20 equals 120 seconds. A 10 second rest between each set means there are 5 total rests for a total of 50 seconds. 120 seconds plus 50 seconds gives a final total of 170 seconds.
|
medium
|
2SdMmx_sLNc
| 327 |
How-To
|
How many different ways does the instructor stretch when a red triangular graphic appears onscreen?
|
[
"A. 1",
"B. 0",
"C. 4",
"D. 2",
"E. 3"
] |
C
|
I saw the instructor perform a stretch while standing with a red triangular graphic over his waist area at 00:29-00:31. During that timeframe, the instructor also performs a stretch while sitting on a mat with a red triangular graphic on top of his waist area. I counted both of these stretches. Then, I saw the instructor perform another type of impromper hamstring stretch while standing with a red triangular graphic at his waist area between 05:51-05:52. I counted this as another type of stretch. Then, I saw the instructor perform another type of stretch, a correct hamstring stretch, while standing with a red triangular graphic at his waist area between 06:06-06:09. I counted this stretch. Since no other red triangles appear in the video, I added up the different stretches the instructor performs when a red triangular graphic appears onscreen and arrived at 4.
|
long
|
2SdMmx_sLNc
| 328 |
How-To
|
What are all the objects used throughout the video to help with the demonstrations that aren't mentioned by the instructor?
|
[
"A. Mat and exercise table.",
"B. Jump rope and foam roller.",
"C. Stool and ball.",
"D. Stretch-out strap and mat.",
"E. Exercise table and foam roller."
] |
A
|
While watching, I looked for the different objects that the instructor used to help with the demonstrations. At 01:14, the instructor talks about using a foam roller. At 02:23, the instructor shares that he is using a stretch-out strap for the demonstration. Then, at 05:27, the instructor shares that he is using a stool. There was also a mat used at 00:14 and an exercise table in the video at 02:38, but the instructor did not mention those objects. Therefore, the objects used throughout the video to help with the demonstrations that aren't mentioned are the mat and exercise table.
|
medium
|
2SdMmx_sLNc
| 329 |
How-To
|
If the instructor wanted to finish the video in the same position as he was in the beginning, where would the instructor have to move to?
|
[
"A. To the left.",
"B. To the top.",
"C. Nowhere, he's in the same position.",
"D. To the bottom.",
"E. To the right."
] |
E
|
I watched the beginning of the video and noticed that the instructor was standing in the middle of the screen starting at 00:00. Then, I went to the very end of the video at 06:48 and noticed the instructor was standing on the right side of the screen and not in the middle. So, if the instructor wanted to be in the middle again he would have to move more towards the left of the screen. But while looking at the instructor the screen's left is his right, so he would have to move to the right to be positioned more left on the screen. Therefore, if the instructor wanted to finish the video in the same position as he was in the beginning, he would have to move to the right.
|
medium
|
2SdMmx_sLNc
| 330 |
How-To
|
What is the difference between the amount of single-leg exercises the instructor does with his right leg compared to his left leg?
|
[
"A. 2",
"B. 3",
"C. 0",
"D. 1",
"E. 4"
] |
C
|
I saw in the video that he does 4 single leg exercises: Foam Roller Mobilization from 01:07 to 02:00, Supine Hamstring stretch from 02:31 to 03:48, Seated Hamstring stretch from 03:59-05:06, and standing hamstring stretch from 05:31 to 06:28. Of these, he demonstrates the first 2 with only his left leg, while he demonstrates the last 2 with his right leg. Then to find the difference, I subtracted 2 from 2 and got 0. Hence, the answer is 0.
|
medium
|
2SdMmx_sLNc
| 331 |
How-To
|
In what order do the shapes used to demonstrate the movement of the supine hamstring stretch appear?
|
[
"A. Arrow, line, triangle, line.",
"B. Line, arrow, line, triangle.",
"C. Line, arrow, line, arrow.",
"D. Arrow, line, arrow, triangle.",
"E. Triangle, line, arrow, line."
] |
B
|
I watched the video until a graphic appeared at 02:33 showing the trainer is about to do the "Supine hamstring stretch". The trainer picks up the yoga strap and begins to demonstrate, and at 02:45 I can see a line parallel to their leg. At 02:48, an arrow appears and points to the right, mirroring the motion of the trainer's leg. At 02:55, another line appears parallel to the trainer's back. Finally, a triangle appears over the trainer's pelvis at 03:01. Thus the answer is line, arrow, line, triangle.
|
medium
|
2SdMmx_sLNc
| 332 |
How-To
|
How many shots are of the instructor demonstrating the proper way to stretch without talking?
|
[
"A. 6",
"B. 3",
"C. 7",
"D. 5",
"E. 8"
] |
D
|
While watching, I looked for moments in the video where the instructor was demonstrating a move without talking. These are the following timeframes where this occurs: 01:46 - 01:52, 03:04 - 03:09, 03:27 - 03:30, 05:01 - 05:08 and 06:19 - 06:24. There are no other shots after that where the man is demonstrating the proper way to stretch without talking. There are two shots with the instructor stretching without talking, which occur from 00:13-00:19, and 00:19-00:25, but they are not considered the proper way based on the text that I read that said "Bad Ideas," which appears at 00:26 along with the two previous stretches, so I didn't count them. Then, I counted these moments up and got 5. Therefore, there are 5 shots where the instructor is demonstrating a proper stretch without talking.
|
medium
|
2dKCBcRehFY
| 333 |
Animals
|
Which greyhound passed the other dogs the most during the race?
|
[
"A. 5.",
"B. 4.",
"C. 6.",
"D. 3.",
"E. 2."
] |
C
|
I watched the race between 02:58 and 03:26. I saw that greyhound number 6 passed 2 dogs at 03:05, number 2 passed number 1 at 03:01, and number 5 passed dog number 4 at 03:07. I continued watching until the end of the race and did not see any more greyhounds passing another. This makes number 6 the one who passed the most dogs.
|
medium
|
2dKCBcRehFY
| 334 |
Animals
|
What was the order by which each greyhound was loaded into the cage before the start of the race?
|
[
"A. 5, 1, 2, 4, 6.",
"B. 5, 2, 1, 4, 6.",
"C. 5, 2, 4, 1, 6.",
"D. 5, 4, 1, 2, 6.",
"E. 5, 1, 4, 2, 6."
] |
E
|
I watched from 01:35 to 01:51 and noticed that the greyhounds were lined up in front of the cages. The front view of the cages at 01:57 shows the handlers putting a greyhound into cage number 5, which matches the tag of the same greyhound seen at 01:44 with the orange tag. This means that each greyhound was lined up in order, in front of their respective numbers. From 02:17 to 02:25, I saw greyhound #5 was secured into its cage first. Greyhound #1 was secured in its cage from 02:21 to 02:25. Greyhound #4's securement followed from 02:28 to 02:33. Greyhound #2 followed from 02:33 to 02:36. Greyhound #6 was the last to be secured, from 02:36 to 02:41. This means the order of each greyhound's loading in their cages was 5, 1, 4, 2, and 6.
|
medium
|
2dKCBcRehFY
| 335 |
Animals
|
If the race had been 50m longer and dog #2 maintained its average speed, what is the sum of dog #2's new winning time when combined with the duration of the tractor driving on the racetrack?
|
[
"A. 58.30 seconds.",
"B. 59.12 seconds.",
"C. 59.06 seconds.",
"D. 59.03 seconds.",
"E. 58.95 seconds."
] |
D
|
At 07:13, I saw several orange banners on the screen that displayed the length of the race as 480m and the winning dog, dog #2’s, time as 28.10 seconds. First I had to figure out dog #2’s average speed for each meter which I got by dividing 28.10 by 480. I got approximately .0585 seconds as the average time it takes dog #2 to run a single meter. I then multiplied 50 meters by .0585 and got 2.927 as the total amount of time it would have taken dog #2 to run an additional 50 meters. Finally, I added 2.927 to 28.10 and arrived at 31.03 seconds as the amount of time it would have taken dog #2 to run the race if it had been an additional 50 meters in length. I then identified the tractor from 05:14 to 05:21, which is 7 seconds. The next shot also shows the tractor from 05:21 to 05:42, which is 21 seconds, driving on the racetrack behind the white fence. The tractor does not appear in any other instance of the video, so the tractor drove on the racetrack for 28 seconds in total. When combined with dog #2's new time, this totals 59.03 seconds.
|
long
|
2dKCBcRehFY
| 336 |
Animals
|
Which number Greyhound was able to keep up the longest throughout the race with the winning Greyhound?
|
[
"A. Number 1.",
"B. Number 6.",
"C. Number 4.",
"D. Number 5.",
"E. Number 2."
] |
A
|
I closely observed the race beginning at timestamp 02:57, with Greyhound number 2 taking the lead. Throughout the timestamp leading up to 03:23, Greyhound number 1 remained in close pursuit of Greyhound number 2 for the majority of the race until Greyhound number 6 ultimately overtook Greyhound number 1 to secure second place behind Greyhound number 2 at the race's conclusion.Therefore, Greyhound number 1 keeps up with Greyhound number 2 for the longest duration throughout the race.
|
medium
|
2dKCBcRehFY
| 337 |
Animals
|
What is the difference between the number of people who first entered the blue stage and the number of people shown using their phones after the second replay of the race?
|
[
"A. 3.",
"B. 5.",
"C. 4.",
"D. 1.",
"E. 2."
] |
D
|
I identified the blue stage at 05:03, when no one had yet stood on it. I began counting at 05:08, when three people stepped on to the stage. I continued to watch and saw that another person entered the stage at 05:13. the clip ends at 05:14. This totals 4 people who first entered the stage. I then looked for the second replay of the video. I found that the first replay, identifiable by the orange icon in the top right corner, began at 03:54 and ended at 04:31. I continued watching and saw that the second replay began at 06:19 and ended at 06:38. For the rest of the video, I observed the people in the setting for anyone using their phones. I spotted one person at 07:11 at the far left using their phone and did not see another person using their phone for the rest of the video. This totals 1 person. The difference between the number of people who first entered the blue stage, 4, and the number of people using their phones after the second replay, 1, is 3.
|
long
|
2dKCBcRehFY
| 338 |
Animals
|
What was the color of the number on the tag of the greyhound that came in second place?
|
[
"A. White.",
"B. Red.",
"C. Orange.",
"D. Yellow.",
"E. Black."
] |
B
|
I watched the race between 02:58 and 03:26. At 03:26, the greyhounds crossed the finish line. I heard the announcer call out the numbers of the first 3 dogs who crossed the finish line, 2, 6 and 1. I went back to right before the beginning of the race, at 02:57, to look at the number 6. The number 6 is on a striped background and is red.
|
medium
|
2dKCBcRehFY
| 339 |
Animals
|
In the crowd shot after the second tractor shot, where is the double decker bus?
|
[
"A. Parked next to a blue storehouse.",
"B. Parked next to a sandy building.",
"C. Parked in the grass.",
"D. Parked in a lot by a van.",
"E. Parked next to a blue stand."
] |
B
|
I saw the first shot of the tractor beginning at 05:14. I continued watching and saw that the second shot of the tractor begins at 05:21 and ends at 05:42 as it transitions into the shot of the crowds. I observed the setting carefully and spotted the red double decker bus next to a sandy colored building.
|
medium
|
2dKCBcRehFY
| 340 |
Animals
|
When the symbol of a yellow star first appears on screen, which word has the same number of letters as the total number of scenery shots after the race ended?
|
[
"A. Derby.",
"B. Sports.",
"C. Greyhound.",
"D. Star.",
"E. Gain."
] |
D
|
I scanned the setting carefully for a yellow star symbol and found that it first appeared at 01:56. "Star" has 4 letters, "Sports" has 6 letters, "Greyhound" has 9 letters, "Derby" has 5 letters, and "Gain" is not on screen. I then found that the race ended at 03:27, when the greyhounds crossed the finish line and the announcer called the winner. For the rest of the video, I looked for scenic shots that showed the setting of the venue with no particular subjects in frame. I counted one shot from 03:31 to 03:53, one from 05:14 to 05:20, one from 05:21 to 05:48, and one from 05:48 to 06:18. This totals 4 shots of scenery and matches the number of letters in the word, "Star".
|
medium
|
2tapJf1frt0
| 341 |
Animals
|
After adding up all the millimeter totals on the sheet of paper illustrated at the timestamp 09:58, and then adding the average length of Louisiana Pine Snake hatchlings according to the video, how many total millimeters are there?
|
[
"A. 2,217.41mm-4,130.04mm.",
"B. 1,912.63.41mm-2,217.41mm.",
"C. 693.41mm-1,912.63mm.",
"D. 1,912.63mm-2,217.41mm.",
"E. 4,130.04mm-4,530.04mm."
] |
D
|
First, I went to the 09:58 timestamp in the video. I saw that there were 7 millimeter measurements marked down, each one corresponding to an egg. These 7 millimeter measurements were—96.74,93.37,93.45,98.24,99.53,115.67,96.41. When added all together, the sum is 693.41. I marked this number down for later. I then continued watching the video, waiting for any mention of the length of Louisiana Pine Snake hatchlings. From 10:47-10:50, the speaker begins to say, in reference to the hatchlings, "they usually range from 4 to 5 feet in length." Since the length was in feet, I converted 4 feet to millimeters, getting 1219.2mm. I then did the same thing with 5 feet, getting, 1524mm. I then added 1219.22mm to 693.41mm to get 1,912.63 millimeters. Then added 1524 mm to 693.41 to get 2,217.41 millimeters. So the total after adding up all the millimeter totals on the sheet of paper at the 09:58 timestamp, and additionally adding the average length of Louisiana Pine Snake hatchlings is between 1,912.63 millimeters and 2,217.41 millimeters.
|
long
|
2tapJf1frt0
| 342 |
Animals
|
Directly after the man jokes about how he still has all of his appendages after 25 years of running an alligator business, how many alligators would be visible in the video if 2 of them were removed?
|
[
"A. 4.",
"B. 8.",
"C. 12.",
"D. 10.",
"E. 6."
] |
B
|
I watched the video to find the time when a man jokes about how he still has all of his appendages after 25 years of running an alligator business. I found this joke in a voiceover which occurs from 18:51-19:06. The man mentions during this voiceover that he and his brother started an alligator business 25 years ago, and then the joke about his appendages occurs right at 19:06. Directly after this moment, at 19:07, I looked for a group of alligators, and found them to be shown all lined up in a row at that time with 2 men attending to them. I counted the alligators, and there were 10. If 2 of them were removed, there would be 8, which makes that the answer.
|
medium
|
2tapJf1frt0
| 343 |
Animals
|
If you were to combine the first spoken word of the video, with the first animal mentioned, with the last full written word of the video, what nonsensical phrase/word combination would you get?
|
[
"A. To crocodile Alive.",
"B. In Bald Eagles Alive.",
"C. In Bald Eagles of.",
"D. In crocodile of.",
"E. To Bald Eagles of."
] |
C
|
First I watched the video and listened for the first spoken word. It happens at the very start of the video at 00:02, when the speaker says "in." I then continued watching, waiting for an animal to be mentioned. At 02:18 the speaker mentions "Bald Eagles," the first animal specifically mentioned in the video. I continued watching, paying attention to written words, to see which one would be last. During the last second of the video at 27:02, in a graphic of a production company, the last full word is shown as "of." Combining these words in orders results in the nonsensical phrase "In Bald Eagles of."
|
medium
|
2tapJf1frt0
| 344 |
Animals
|
If you were to subtract the number of states where the United States' national bird was threatened in 1978 from the number of states where that same bird was "Fully Recovered" in 2007, what number would you get according to the video?
|
[
"A. 48.",
"B. 42.",
"C. 43.",
"D. 44.",
"E. 49."
] |
C
|
First, I noted to myself that the United States' national bird is the Bald Eagle. I then watched the video, paying attention to any mention of the Bald Eagle and its endangered or recovered status. At 23:12, a clear map of the continental United States appears with the title "Bald Eagle Status (1978)." The map has a key that shows states colored yellow have the "Threatened" status for Bald Eagles. Michigan, Wisconsin, Minnesota, Washington, and Oregon are all colored yellow. I noted that this means that in 5 states in 1978 the Bald Eagle was threatened. At 23:15, the map changes. It is still of the continental states, and still depicts Bald Eagle Status, though in 2007. It also has a different key, showing that green denotes states where the Bald Eagle status is "Fully Recovered." All the states shown are colored green, meaning the number of states where the Bald Eagle was fully recovered in 2007 is 48 (as Hawaii and Alaska are not depicted in the map). I then subtracted the number of states where the Bald Eagle was threatened in 1978 (5) from the number of states where the Bald Eagle was fully recovered in 2007 (48), to get 43.
|
long
|
2tapJf1frt0
| 345 |
Animals
|
If you were to take the number of traffic lights displaying red arrows at 01:14 and multiply by the first number explicitly said in the video, what number would you get?
|
[
"A. 798.",
"B. 1,600.",
"C. 802.",
"D. 640.",
"E. 400."
] |
B
|
First, I went to the 01:14 timestamp and stopped the video. I studied the scene and counted 2 traffic lights displaying red arrows. I then started the video over and listened for explicitly stated numbers. I noted that at 01:21 the narrator says "...more than 800 animals..." and that this was the first explicitly stated number. I then multiplied the number of traffic lights displaying red arrows at 01:14 (2) by the first number explicitly said in the video (800) to get 1,600.
|
medium
|
2tapJf1frt0
| 346 |
Animals
|
How many green alligator skin purses with handles would be visible from 19:00-23:00 if 1 more was added?
|
[
"A. 10.",
"B. 14.",
"C. 11.",
"D. 8.",
"E. 15."
] |
A
|
I watched the video from 19:00-23:00 in order to identify and count how many green alligator skin purses with handles are visible during that time. I found the following green purses with handles visible at least partially in the frame: 1 at 19:16-19:18, 4 at 19:18-19:21, and 4 at 22:10-22:12. I was able to identify them as alligator skin purses because of the voiceover narration, which mentions crocodilian species at 19:15. So, the total number visible is 9. If 1 more was added, there would be 10, making that the answer.
|
medium
|
2tapJf1frt0
| 347 |
Animals
|
Before a named man explains that 6-8% of alligator eggs will survive to become 4-foot alligators, what name had been the most recent one to be shown onscreen?
|
[
"A. Michael Seymour.",
"B. Rick Atkinson.",
"C. Amity Bass.",
"D. Noel Kinler.",
"E. Keri Landry."
] |
D
|
I watched the video to find when a named man explains that 6-8% of alligator eggs will survive to become 4-foot alligators. I found him at 20:47, when his name appears on screen, which is Ted Falgout. He mentions this fact about alligator eggs from 20:54-21:00. Armed with this knowledge, I then sought to locate which name had been the most recent one to be shown onscreen before Ted Falgout. Looking backward, I found the name of Noel Kinler on the screen from 19:25-19:29. No other names appear between 19:29-20:47. So, the answer must be Noel Kinler.
|
medium
|
3X3tKlr5am8
| 348 |
Short Films
|
When does the first segment that has the performers singing begin?
|
[
"A. 4:04.",
"B. 0:58.",
"C. 3:22.",
"D. 0:36.",
"E. 5:30."
] |
B
|
While I was watching, I was listening to the music. During the beginning, the performers just danced to a beat. It wasn't until the next performance at 00:58 that I heard lyrics being played along with the music.
|
medium
|
3X3tKlr5am8
| 349 |
Short Films
|
When are the male and female dancers seen together dancing?
|
[
"A. At the end.",
"B. Once in the middle and once at the end.",
"C. Once at the beginning and twice at the end.",
"D. Once in the middle.",
"E. Once at the beginning."
] |
C
|
I watched the performances and noticed that the video consisted of different performances. So I searched for performances where both male and female dancers performed together on stage. They performed once at the beginning at 01:00 and then twice at the end at 07:09 and 07:51.
|
medium
|
3X3tKlr5am8
| 350 |
Short Films
|
What happens after the female soloist performs?
|
[
"A. A male soloist dances.",
"B. A troupe of children dance.",
"C. The band performs on the dancefloor.",
"D. The performance is complete.",
"E. Another female soloist joins her."
] |
A
|
I found the female soloist, who performs at 01:51 - 02:35. Then, at 02:35, I saw the video dissolve to a wide shot of the male soloist, who dances next.
|
short
|
3X3tKlr5am8
| 351 |
Short Films
|
What two primary colors compose the cloth skirts of the third unique group of dancers seen wearing skirts made primarily from cloth rather than plants?
|
[
"A. Green and gold",
"B. Pale blue and yellow",
"C. Navy and white",
"D. Red and pale yellow",
"E. White and tan"
] |
C
|
I looked for unique groups of dancers in the video and found the first appears momentarily at 00:01 and that they wear black cloth skirts. I counted this as the first group. The next few sets of unique groups of dancers wear skirts made primarily from green leaves, so I did not count them. Two solo dancers perform wearing cloth skirts but since they are soloists and not part of a group, I did not count them. The second unique group of dancers wearing cloth skirts begins performing at 03:22. They are followed by the third group of dancers wearing cloth skirts at 04:44. I observed that the cloth skirts of this group of dancers are made up of navy cloth with a white pattern. Therefore, the correct answer is navy and white.
|
medium
|
3X3tKlr5am8
| 352 |
Short Films
|
Some of the musicians have large cylindrical pieces of polished wood. What are they doing with them?
|
[
"A. They are using them as a stand for a set of two small hand drums.",
"B. They are using them as a percussion instrument by tapping them on the side with a wooden wand.",
"C. They are using them as a percussion instrument by playing on the top of them with their hands.",
"D. They are not for music, they are a decorative music stand.",
"E. The are using them as a percussion instrument by scraping a metal comb over the ridged parts."
] |
B
|
I found the musicians with the wooden cylinders at 05:53. From then until 06:55, I watched them play the cylinders by tapping on them with a wooden hand.
|
short
|
3X3tKlr5am8
| 353 |
Short Films
|
What has been placed around the stage at 07:32?
|
[
"A. There are rows of benches placed around the edges of the stage.",
"B. There are potted plants placed at wide intervals around the edges of the stage.",
"C. There are sheets of metallic blue plastic around the edges of the stage.",
"D. There are regularly placed buckets filled with palm fronds around the edges of the stage.",
"E. There are large wooden pools filled with water around the edges of the stage."
] |
B
|
I found the stage at 07:32. At the same time, I then noticed there were potted plants placed at wide intervals around the edges of the stage.
|
short
|
3X3tKlr5am8
| 354 |
Short Films
|
What is the male soloist's crown made of after 02:35?
|
[
"A. Pearls.",
"B. Gold.",
"C. Plants.",
"D. Bone.",
"E. Rubies."
] |
C
|
After 02:35, I saw the video dissolve to a wide shot of the male soloist. Then, I noticed his crown was made of plants.
|
short
|
3lxklYVZYEk
| 355 |
Short Films
|
Who is the first person to speak during the film?
|
[
"A. Hendrickx Ntela.",
"B. Beast.",
"C. Grichka Caruge.",
"D. Kwame Osei.",
"E. Sally."
] |
D
|
I went to the beginning of the film and paused it at 00:58 when the first person appeared on the screen talking. I then read the white text next to his head that read "KWAME OSEI".
|
short
|
3lxklYVZYEk
| 356 |
Short Films
|
What is the color of the man's hat between 06:22 and 06:28?
|
[
"A. Pink.",
"B. Orange.",
"C. White.",
"D. Red.",
"E. Blue."
] |
A
|
I scrolled to the specified section of the video at the 06:22 mark, and I located a man wearing a pink. I continued watching until 06:28 to ensure he did not wear any other colored hats.
|
short
|
3lxklYVZYEk
| 357 |
Short Films
|
What is the primary color of the cap featured in the fifth color shot in the video that shows one or more caps?
|
[
"A. Yellow",
"B. Gray",
"C. Pink",
"D. Red",
"E. Black"
] |
C
|
I saw at least one person wearing a cap in the first minute of the video, but the shots were in black and white so I did not count that instance. The first shot in color that features individuals wearing caps begins at 01:19. I counted this as the first instance. This shot is followed by another shot in color of individuals wearing caps at 01:20. A third shot in color of a person wearing a cap occurs at 01:24. A fourth appears at 01:51. The fifth shot in color of a person wearing a cap occurs at 01:58. I observed the color of this cap and determined it to be pink.
|
medium
|
3tisOnOkwzo
| 358 |
Tech/AI
|
If there were twice as many golgi apparati in the plant cell diagram, how many more chloroplasts than golgi apparati would there be?
|
[
"A. 2.",
"B. 5.",
"C. 3.",
"D. 1.",
"E. 4."
] |
A
|
I listened to the narrator say, "plant cell" at 04:26 while the video showed a cell diagram. It appeared to be a typical cell diagram with only 1 golgi apparatus. At 04:29, the narrator identifies the green oblong shapes as chloroplasts. I went back to the full diagram at 04:26 and counted 4 chloroplasts. Twice as many golgi apparati would be 2, so 4-2=2.
|
medium
|
3tisOnOkwzo
| 359 |
Tech/AI
|
How many stop codons are found in the mRNA sequence shown at 07:31 in the video after being decoded?
|
[
"A. 4.",
"B. 2.",
"C. 0.",
"D. 3.",
"E. 1."
] |
E
|
I looked at 07:32 to find the mRNA sequence mentioned in the question. I see a DNA sequence on the screen, and I hear the narrator say that there is a way to decode the strand of DNA. At 07:34 a chart appears on the screen containing triplets of letters. UAA, UAG and UAA all correspond to stop. I go back and look at the DNA sequence at 07:32, AUGACGUACGUAUGCUAGUUAGCC and I count in triplets, decoding the 3 letters with the corresponding amino acid or action in the chart and adding up the number of stops that are in the RNA sequence. There is only one stop codon in the sequence UAG.
|
medium
|
3tisOnOkwzo
| 360 |
Tech/AI
|
The narrator tells us how long the DNA in a single cell would be if stretched out; if you were to stretch out the DNA of all the cells on the screen that have a thumbs up beside them at 12:17, about how long would their DNA be all together?
|
[
"A. 24 meters.",
"B. 48 meters.",
"C. 8 meters.",
"D. 4 meters.",
"E. 32 meters."
] |
C
|
I begin watching the video listening for the narrator to say how long the DNA in a single cell would be if stretched out. At 8:03, I hear the narrator say "if you were to stretch out the DNA of one cell it would be about 2 meters long." I go to 12:17 in the video to determine how long the DNA from all the cells present on screen would be if it were stretched out. At 12:17, I see four cells with a thumbs up beside them. I know that each cell's DNA when stretched out is about 2 meters long. I perform the math two times four and get a final answer of 8 meters.
|
medium
|
3tisOnOkwzo
| 361 |
Tech/AI
|
In the video directly after the cold emoji appears onscreen, there are some molecules of water on the left side of the cell membrane and then the move, why did water travel across the cell membrane?
|
[
"A. To balance pH.",
"B. To maintain homeostasis.",
"C. To maintain ion balance.",
"D. To make ATP.",
"E. To lower the concentration gradient."
] |
B
|
I begin watching the video looking for the cold emoji and molecules of water on screen with a cell membrane. At 02:27, I see the cold emoji appear onscreen. I continue to watch looking for water molecules and a cell membrane to appear. At 02:29, I see molecules of water on the left side of the cell membrane mentioned in the question. In the image, there are 6 molecules on the left side of a cell membrane and 2 molecules of water on the right side of the cell membrane. I hear the narrator say that certain chemicals are being balanced as 2 molecules of water move from the left side of the cell membrane to the right side of the cell membrane. I then go back to the beginning of this section of the video, which begins at 02:18. The narrator then says that every species has one thing in common, "homeostasis," and defines the term at 02:21 as "keeping certain conditions in check." At 02:27 the narrator explains that cells do the same thing by balancing out certain concentrations of certain chemicals. I deduce that the 2 molecules of water are moving across the cell membrane to maintain homeostasis.
|
long
|
3tisOnOkwzo
| 362 |
Tech/AI
|
How many unique appearances of the golgi apparatus are there in the first 3 minutes?
|
[
"A. 3.",
"B. 6.",
"C. 7.",
"D. 4.",
"E. 1."
] |
D
|
I saw a depiction of a eukaryotic cell labeled at 01:37. I then identified the pink structure at the bottom of the cell as a golgi apparatus, due to the stacking of small flat sacs. From 00:00 to 03:00, I saw the golgi apparatus at 01:35, 01:37, 02:27, and 02:42. It is important to note that the same golgi apparatus was on the screen from 01:37 to 01:45. I added the number of times the golgi apparatus appeared and found the total to be 4.
|
medium
|
3tisOnOkwzo
| 363 |
Tech/AI
|
At 06:37, what would the second line of the DNA sequence be after it is transcribed into mRNA?
|
[
"A. CUAGCUGAUCGAGGCUA.",
"B. GATCGACTAGCTCCGAT.",
"C. GAUCGACUAGCUCCGAU.",
"D. GTACGTCATGCACCUA.",
"E. CTAGCTGATCGAGGUA."
] |
A
|
I looked at 06:37 to find the second line of the DNA sequence referenced in the question. The DNA sequence on the second line reads: GATCGACTAGCTCCGAT. The question is asking for the mRNA strand after transcription. I find the narrator discussing the steps of transcription from 06:17 to 06:32. On the screen, I see that complementary base pairs are as follows: A pairs with U, T pairs with A, C pairs with G, and G pairs with C. Based on this logic, the 2nd line of DNA after being transcribed into mRNA is CUAGCUGAUCGAGGCUA.
|
medium
|
3wEth2tcL5k
| 364 |
Maths
|
If we add the largest number shown in the video to the smallest number shown in the video and divide them by 100000000000, what is the result rounded to 2 decimal points?
|
[
"A. 4.13 x 10^{76}.",
"B. 4.11 x 10^{73}.",
"C. 3.11 x 10^{71}.",
"D. 2.01 x 10^{70}.",
"E. 6.41 x 10^{78}."
] |
B
|
I began watching the video and noticed they discussed a bunch of constants. These constants varied. At 00:50, a number of 3.3598856662 was shown. At 01:42, I saw the number 137.5. At 02:51 I was the number -2.89. At 06:03, the number 3263442 was shown. At 11:31, many numbers flash across the frame, with variables attached to them. The smallest number from that page was -12. At 11:54, the number 01101001100101101001011001101001 is shown. At 13:07, the number 1221121221221121122121121 is shown. At 13:40, the number 4113101149215104800030529537915953170486139623539759933135949994882770404074832568499 is shown. At 15:45, the number 10^18 appears, but this is smaller than the number shown at 13:07. This ends up being the largest number in the video and -12 ends up being the smallest number. I added those 2 numbers together and then divided the result by 100000000000 to get 4.11 x 10^{73}. Therefore, if we add the largest number shown in the video to the smallest number shown in the video and divide them by 100000000000, the result rounded to 2 decimal points is 4.11 x 10^{73}.
|
long
|
3wEth2tcL5k
| 365 |
Maths
|
The bottom right corner of the screen shows the number of constants discussed. What is the product of the number of circles that appear between 08:23 and 14:10 and the constant “21?”
|
[
"A. 1.70142.",
"B. 10.87313.",
"C. 4.33480.",
"D. 2.26856.",
"E. 92.56276."
] |
D
|
At 08:35, a circle is drawn around an ellipse, and the narrator says that a circle is drawn. A smaller circle is formed at 09:02, and the narrator continues to talk about the circle and its properties. At 09:06, another larger circle is shown. The narrator talks about both of these shapes. At 09:15, the circle and ellipse are both transformed into another circle and ellipse, but the narrator doesn’t discuss that change. No more circles appear during that time period. Therefore, there are 4 circles that appear during this time period. At 05:28, the Omega Constant is given as the “21” constant. The value of it is approximately 0.56714. Therefore, the answer is 4*0.56714=2.26856.
|
medium
|
3wEth2tcL5k
| 366 |
Maths
|
What is the value of the expression (13th-21st)^(3rd) where the counts refer to constants in the video?
|
[
"A. 1.74513.",
"B. 4.61871.",
"C. 1.53542.",
"D. 4.2249.",
"E. 0.21168."
] |
E
|
I begin watching the video, looking for the 3rd constant. I see the 3rd constant at 00:20 which is Euler's constant. I see the 13th constant, Viswanath's constant, which is equal to 1.131988, at 02:36. I see the 21st constant, the omega constant, which is equal to 0.56714, at 05:31. Then to perform the calculation I take (1.131988-0.56714)^e which gives 0.21168. Therefore, the value of the expression (13th-21st)^(3rd) where the counts refer to constants in the video is 0.21168.
|
medium
|
3wEth2tcL5k
| 367 |
Maths
|
If the value of the continued fraction used to demonstrate Loch's constant when it has 4 terms in its denominator is multiplied by the value of the continued fraction when it has 6 terms in its denominator, what is the resulting value?
|
[
"A. 0.1694.",
"B. 1.5354.",
"C. 0.2116.",
"D. 1.7451.",
"E. 4.6187."
] |
A
|
I begin watching the video for when Loch's constant comes up, which happens at 03:20. At 03:23, I see the continued fraction has 4 denominators and the value is approximately 0.41162228. At 03:25, I see the continued fraction has six denominators and the value is approximately 0.4116251482. So 0.4116251482 multiplied by 0.411622 is 0.16943408. Therefore, if the value of the continued fraction used to demonstrate Loch's constant when it has 4 terms in its denominator is multiplied by the value of the continued fraction when it has 6 terms in its denominator, the resulting value is 0.1694.
|
medium
|
3wEth2tcL5k
| 368 |
Maths
|
At what time does the largest number in the video appear on-screen?
|
[
"A. 01:42.",
"B. 00:50.",
"C. 13:40.",
"D. 11:54.",
"E. 13:07."
] |
C
|
I began watching the video and noticed several very large numbers. At 01:42, I saw the number 137.5. At 06:03, the number 3263442 was shown, which is larger than 137.5. At 11:54, the number 01101001100101101001011001101001 is shown, which is larger than 3263442. At 13:40, the number 4113101149215104800030529537915953170486139623539759933135949994882770404074832568499 is shown, which is larger than the number shown at 11:54. At 15:45, the number 10^18 appears, but is smaller than the number that appeared at 13:40. This ends up being the largest number given in the video. However, it is not said out loud and is briefly shown in a very small font at the bottom center of the screen when talking about Mill’s constant. Therefore, the largest number in the video appears on-screen at 13:40.
|
medium
|
3wEth2tcL5k
| 369 |
Maths
|
What is the fifth term in the third sequence mentioned?
|
[
"A. 5.",
"B. 3.",
"C. 1.",
"D. 0.",
"E. 2."
] |
E
|
While watching the video, I paid close attention to each sequence. The first sequence I saw was at 00:39. At 01:58 I see the Fibonacci sequence is again. The third sequence I see at 02:04 and its fifth term is 2. Therefore, the fifth term in the third sequence is 2.
|
medium
|
3wEth2tcL5k
| 370 |
Maths
|
What is the sum of every constant whose name starts with a C that appears in this video if all the numbers' printed values are in base 10?
|
[
"A. 3.21997",
"B. 3.45568",
"C. 3.34557",
"D. 3.57656",
"E. 3.09866"
] |
B
|
I begin watching the video looking for constants which start with a C. I see Cahen's constant at 06:16 which is approximately equal to 0.64341. At 06:27 I see Catalan's constant with the approximate value 0.91596559. At 11:29 I see Conway's constant with the approximate value 1.303577. At 12:22 I see the video discuss a series of constant called Champernowne constants and show 3 of them with approximate values 0.12345678910, 0.110111001, and 0.12345101112. At 12:30 I see the Copeland-Erdos constant with approximate value 0.2357111317. No other constant whose names begin with a C are shown, and the sum of these is 3.45568. Therefore, the sum of every constant whose name starts with a C that appears in this video if all the numbers' printed values are in base 10 is 3.45568.
|
medium
|
3wEth2tcL5k
| 371 |
Maths
|
Excluding 0 and 1, what is the smallest possible value shown when the count of discussed constants displayed in the bottom right corner of the screen reads "11"?
|
[
"A. 1.75.",
"B. 2.",
"C. \\sqrt{2}.",
"D. \\sqrt{2} - 1.",
"E. 0.46."
] |
C
|
I began watching the video and noticed in the bottom right corner of the screen the number corresponding to how many constants had been discussed is shown. This number is not said out loud, but with each constant discussed, it increases by 1. At 01:45, the Magic Angle is discussed. This corresponds to number 11. Number 11 is in the bottom right corner of the screen from 01:45 to 02:13. The smallest number, excluding 0 and 1, is given at 01:54. That number is \sqrt{2}. Therefore, when the count of discussed constants displayed in the bottom right corner of the screen reads "11", the smallest possible value shown, excluding 0 and 1, is \sqrt{2}.
|
medium
|
3wEth2tcL5k
| 372 |
Maths
|
What is the third term in the third series mentioned?
|
[
"A. 2.",
"B. 1.",
"C. 1/3.",
"D. 7.",
"E. 1/5."
] |
E
|
While watching the video, I paid close attention to each series. The first series I saw was at 00:49 while discussing the reciprocal Fibonacci constant. The second series I saw was the harmonic series at 04:16. The third series I saw was at 04:28, and it was the sum of the reciprocals of prime numbers, so the third term was 1/5. Therefore, the third term in the third series mentioned is 1/5.
|
medium
|
3wEth2tcL5k
| 373 |
Maths
|
The bottom right corner of the screen displays the number of constants discussed. What is the quotient when the number of distinct words (hyphenated words count with non-hyphenated words) containing the letter "f" (shown on-screen from the beginning of the video to the 9:00 mark) is divided by the 37th constant?
|
[
"A. 5.234",
"B. 1.309",
"C. 2.617",
"D. 3.926",
"E. 6.543"
] |
E
|
I was watching the video and noticed many words coming onto the screen, but not many containing the letter “f.” At 00:39, the Fibonacci sequence is talked about. The word Fibonacci contains an f. It appears several more times throughout the video, but only counts as 1 distinct word. At 02:55, the Embree-Trefethen constant is discussed. Trefethen contains an f. At 04:40, the word function appears on screen. At 05:35, Gelfond’s constant is discussed, as is Gelfond-Schneider which is not distinct from Gelfond. At 07:59, the word “for” appears on screen, as part of the phrase “Brun’s constant for prime quadruplets.” Therefore, a total of 5 distinct words that contain the letter f appear on-screen from the beginning of the video to the 9 minute mark. All of these words appear on screen, but are spoken too. However, many more words containing the letter “f” are spoken by the narrator. At 10:56, the Landau-Ramanujan constant is given. It is the 37th constant discussed, with a value of 0.76422… Therefore, the quotient is 5/0.76422 which is approximately 6.543, when rounded to 3 decimal places.
|
long
|
3zrHa2Qh0I0
| 374 |
Short Films
|
What does the setting look like when the man in the hat is brushing the woman's hair?
|
[
"A. They are in a bathroom.",
"B. They are in a bedroom.",
"C. They are in a gravel pit.",
"D. They are in the Tardis.",
"E. They are in a hair salon."
] |
C
|
I watched the video until 02:38, when the scene cuts to a desolate gravel pit. The camera pans to show the man in the hat bending over to brush the woman's hair while she sits on the ground.
|
short
|
3zrHa2Qh0I0
| 375 |
Short Films
|
What does the man in the bowler hat do in response to the woman saying the line "You sold us out!"?
|
[
"A. He shakes his head.",
"B. He pushes her over.",
"C. He argues with her.",
"D. He runs away.",
"E. He pulls out a gun."
] |
B
|
I watched the scene and listened for the line where the woman says "You sold us out!" which occurs at 00:50. I then continued watching the scene for the man in the bowler hat's response from at 00:53-00:54, I watched him push her to the side, and watched her fall over slightly in response.
|
medium
|
3zrHa2Qh0I0
| 376 |
Short Films
|
Who brushes the brunette girl's hair behind the scenes?
|
[
"A. Acne Kid.",
"B. Bowler Hat Man.",
"C. Balding Twentysomething.",
"D. Blonde actress.",
"E. Male lead."
] |
B
|
I watched the Bowler Hat Man, who has long silky hair, brushing the brunette girl's hair. She is seated on the ground facing away from him as he runs the brush through her hair. They are laughing together and discussing conditioners [2:39-2:51].
|
medium
|
3zrHa2Qh0I0
| 377 |
Short Films
|
Where is the red eraser when the man and the woman are discussing the making of the film?
|
[
"A. Stuck to the dry erase board behind and between them.",
"B. On top of the green helmet next to the woman.",
"C. Sitting on the table in front of them.",
"D. Held in the man's right hand.",
"E. Held in the woman's left hand."
] |
A
|
I watched the video until 04:43, when the scene switches to the man and the woman sitting at a table in a small room. On the wall behind them, visible between them, is a dry erase board. A red eraser is stuck to the board.
|
medium
|
3zrHa2Qh0I0
| 378 |
Short Films
|
Why do the four actors begin to perform a haka?
|
[
"A. To distract from embarrassment after a dropped line.",
"B. To intimidate other actors.",
"C. To kick off a rugby match.",
"D. To celebrate the end of filming.",
"E. To welcome a new cast member to set."
] |
A
|
I watched a scene that began at 01:22. The four actors are standing together, waiting for someone to say their line. As the silence lengthens, the actors begin to look back and forth at one another with unease. At 01:32, the actor playing the Doctor breaks into a haka, at which point the others join him in relief.
|
medium
|
4I36G3B_sPA
| 379 |
Short Films
|
In what order do the following events occur?
|
[
"A. Embodiment of Ben Shapiro's voice, Obi-wan Kenobi's ghost, a clown, a void.",
"B. Embodiment of Ben Shapiro's voice, a clown, a void, Obi-wan Kenobi's ghost.",
"C. Embodiment of Ben Shapiro's voice, Obi-wan Kenobi's ghost, a void, a clown.",
"D. Embodiment of Ben Shapiro's voice, a void, Obi-wan Kenobi's ghost, a clown.",
"E. Embodiment of Ben Shapiro's voice, a void, a clown, Obi-wan Kenobi's ghost."
] |
A
|
I watched to find the start of the argument between the men. At 00:50, the man in black is visibly irritated. I listened to find the insults. At 02:06, the man in gray says "embodiment of Ben Shapiro's voice". At 02:10, the man in black says Obi-wan Kenobi's ghost. At 02:15, the man in gray calls him "a clown". At 02:18 the man in black calls him a void.
|
medium
|
4I36G3B_sPA
| 380 |
Short Films
|
What is the young man doing at 00:16-00:17 when he walks into the room?
|
[
"A. Putting on his jacket.",
"B. Fixing his hair.",
"C. Buttoning his coat.",
"D. Tying his tie.",
"E. Adjusting his cufflinks."
] |
D
|
At 00:16-00:17, the young man walks in the room. As he does, his tie hangs around his neck and he starts tying it while talking to the older man.
|
short
|
4I36G3B_sPA
| 381 |
Short Films
|
The second time the phrase "no offense" is spoken in the video, what is the speaker doing as he says it?
|
[
"A. Eating eggs in the kitchen.",
"B. Walking into the kitchen.",
"C. Leaning over the table.",
"D. Standing with arms crossed.",
"E. Eating cereal at the table."
] |
C
|
I watched the conversation between the two men, listening for each instance of the phrase "No Offense" to be spoken. The first happens at 01:20, and the second at 01:34. I identified the speaker during this second instance as the black-haired man, and watched what he was doing while he said it: he was leaning over the table at 01:34.
|
medium
|
4I36G3B_sPA
| 382 |
Short Films
|
What is in the cabinet behind the old man?
|
[
"A. Family photos.",
"B. Porcelain dolls.",
"C. A tea set.",
"D. An urn full of ashes.",
"E. Collectable baseball cards."
] |
C
|
The video shows the cabinet behind the old man at 00:14. I noticed that the cabinet is filled with a tea set.
|
short
|
4I36G3B_sPA
| 383 |
Short Films
|
What does the younger man do as the video music queues?
|
[
"A. He tries harder to make his point.",
"B. He approaches the older man.",
"C. He just stares at the older man.",
"D. He complains and walks out of the room.",
"E. He screams in frustration."
] |
D
|
I watched the video and listened for when the music first queued at 00:41. I watched the younger man then sigh and walk from the dining room into the kitchen while complaining about the older man not listening from 00:42 to 00:44. Therefore, the younger man left the room.
|
medium
|
4I36G3B_sPA
| 384 |
Short Films
|
Who or what is centered in the shot immediately before the man in gray mentions Alex Jones?
|
[
"A. The man in black.",
"B. A bouquet of flowers.",
"C. A plate of eggs.",
"D. The man in gray.",
"E. A bowl of cereal."
] |
A
|
I listened for a mention of Alex Jones. This happens at 02:42. I looked at the shot immediately beforehand, at 02:40, and identified the man in black as the central focus of that shot.
|
short
|
4M0lZPaJKto
| 385 |
Animals
|
Between 17:10-17:20, as the winner gallops around the arena, how many people in the center of the arena would be visible if there were twice as many people there?
|
[
"A. 30.",
"B. 28.",
"C. 26.",
"D. 22.",
"E. 24."
] |
B
|
I watched the video from 17:10-17:20 to see how many people are present in the center of the arena as the winner gallops around. At 17:13, the first people began to appear, each of them standing near the tables and some of them sitting at computers, all located in the center of the arena. From 17:13-17:20, I counted 14 people visible. A few of them toward the end are walking away from the tables, but they are still located in the center of the arena where the winner is galloping around. If there were twice as many people, there would be 28, making that the answer.
|
medium
|
4M0lZPaJKto
| 386 |
Animals
|
After the announcer says it's time to "report to center ring"--what color is the second horse to be fully visible?
|
[
"A. Dark brown",
"B. Light brown",
"C. Black and white",
"D. Light gray",
"E. Black"
] |
D
|
I watched the video and listened for the announcer to say "report to center ring". This occurred at 10:45. At 10:45, I saw the first fully visible horse was dark brown. From 10:47-10:48 a horse passed by in the foreground. I could not see the entire horse, so I did not count this. The next horse that was fully visible appeared from 10:50-10:52. This horse was light gray.
|
medium
|
4M0lZPaJKto
| 387 |
Animals
|
After the announcer tells the riders to "halt," what is the sum of the numbers visible on the riders who are seen two shots after the shot where "halt" is heard?
|
[
"A. 721.",
"B. 684.",
"C. 906.",
"D. 823.",
"E. 599."
] |
D
|
I watched the video to find the moment when the announcer tells the riders to "halt." I found this moment at 03:30, when the video shows a rider wearing a green coat. I then looked for the subsequent shots, counting to 2. The first subsequent shot begins at 03:33, when a lone rider in a blue-green coat is shown behind two men wearing suits. This shot lasts until 03:36. Then, the next shot begins at 03:36 and goes until 03:40. Since this is the second shot after the shot where "halt" is heard, I identified the numbers the riders are wearing (247 and 576) and added them. The total being 823, I determined that this is the answer.
|
medium
|
4M0lZPaJKto
| 388 |
Animals
|
As the man walks down past the lined up horses from 11:47-12:01, and some of the horses back away from him, how many horses would have backed away from him if 3 fewer horses backed away from him?
|
[
"A. 6.",
"B. 4.",
"C. 3.",
"D. 7.",
"E. 5."
] |
B
|
I watched the video during the 11:47-12:01 time frame in order to first see how many horses back away from the man as he walks down the line of horses. During that time span, 7 total horses back away from the man as he walks past them. If there were 3 fewer horses that backed away from him, that would make the answer 4.
|
medium
|
4M0lZPaJKto
| 389 |
Animals
|
How many times do brown horses move from right to left while the entirety of the first horse's information is on the chyron at the time the announcer says "extended trot, please"?
|
[
"A. 8.",
"B. 2.",
"C. 6.",
"D. 0.",
"E. 4."
] |
C
|
I watched the video listening for the anouncer to say "extended trot, please", which occurs at 02:28. I looked at the chyron at the bottom of the screen, and the first horse's information is given as #562 - CH THE CRESCENDO - MIA PROVENZANO. I went back to see at what time the entirety of the information is on the screen, and it is from 02:19-02:28. I watched the segment again to see how many brown horses move from right to left during that time period, and I counted 6.
|
medium
|
4M0lZPaJKto
| 390 |
Animals
|
Two shots before the rider mouths "sorry," what kind of accessories is the rider wearing?
|
[
"A. Earrings and a brooch.",
"B. Earrings and a monogrammed collar.",
"C. Earrings and a collar with a chain.",
"D. Earrings.",
"E. Earrings and a cameo."
] |
A
|
I watched the video looking for a rider mouthing the words "I'm sorry", which happens at 12:44. I went back two shots before this, to a shot beginning at 12:30. The rider featured in this shot is wearing earrings and a brooch.
|
medium
|
4M0lZPaJKto
| 391 |
Animals
|
Directly after the third time that the words "FREEDOM HALL" become visible in their entirety, how many horses would be featured on the screen if there were 5 additional horses?
|
[
"A. 6.",
"B. 7.",
"C. 15.",
"D. 10.",
"E. 11."
] |
D
|
I watched the video and looked for the times when the words "FREEDOM HALL" become visible in their entirety. I found the first instance of this from 03:30-03:33, when the words are visible as a large sign on the side of the arena, in the midst of the stands. A second instance occurs from 03:47-03:48. After this, the next instance where the words become visible is from 06:20-06:21. Having found the third instance, I looked to see how many horses are featured on the screen. At 06:22, I counted 5 horses. If there were 5 more, there would be 10 total, making that the answer.
|
medium
|
4M0lZPaJKto
| 392 |
Animals
|
When the announcer says where the 1st prize rider is from, how many more letters are in the name in red at the top right than the name in red at the lower left?
|
[
"A. 4.",
"B. 7.",
"C. 6.",
"D. 0.",
"E. 5."
] |
C
|
I listened for the winning horse to be announced, which occurs at 14:25. I continued listening for the 1st prize rider's name at 14:30, and where the rider was from, at 14:32. At that point I looked onscreen for a name in red, of which there are four. The one at the top right is Chief of Spindletop, with 17 letters, and at the lower left is Night Flower, with 11. 17-11=6, making the answer 6.
|
medium
|
4M0lZPaJKto
| 393 |
Animals
|
When the horse who wins a place two lower than the horse with a male rider is shown facing the camera, how many people onscreen are seen wearing masks?
|
[
"A. 4.",
"B. 2.",
"C. 1.",
"D. 3.",
"E. 5."
] |
C
|
I watched the video looking for the horse with a male rider to win something, which occurs at 15:36. He is announced as the 5th place winner. I continued watching, waiting for the announcer to announce the 7th place winner, which occurs at 16:00. I then waited for the horse and rider to be facing the camera, which occurs at 16:08. At this time, there is 1 person onscreen wearing a mask.
|
medium
|
4n_mRf7j920
| 394 |
Short Films
|
During Tony's interview, there is a blue longsleeve shirt on the rack behind him. What number is represented on the shirt?
|
[
"A. 95.",
"B. 93.",
"C. 78.",
"D. 98.",
"E. 24."
] |
B
|
While watching the video, I analyzed the background elements presented during Tony's interview. I noticed that the number 93 is on a blue long sleeve shirt from 00:38-00:50 that a merchant seems to be selling. The shirt remains on a rack for the duraiton of the interview.
|
medium
|
4n_mRf7j920
| 395 |
Short Films
|
What does the man in the "KIA" shirt pretend to do at the end of his performance?
|
[
"A. Drop a microphone.",
"B. Shoot a basket.",
"C. Faint.",
"D. Shoot a gun.",
"E. Trip."
] |
D
|
I watched the video and looked for the man in the "KIA" shirt. I found this text in large print on the back of a black shirt at 01:36. I continued watching until the end of the segment, which occurred at 01:39. I went backwards and looked for when this person was visible from the front and found them onstage at 01:17. I looked for what happened just before the man in the "KIA" shirt walked off stage. At 01:28, I noticed a man behind the man in the "KIA" shirt pretended to toss something up in the air. Immediately after, the man in the "KIA" shirt lifted both his arms up as if he was holding a rifle. I heard the sound of a gunshot at 01:29 and then saw him put his hands down and walk off stage.
|
medium
|
4n_mRf7j920
| 396 |
Short Films
|
In what order did the instructors perform?
|
[
"A. Tony, Kenzo, Ian, and Keone & Mari.",
"B. Kenzo, Keone & Mari, Ian, and Tony.",
"C. Kenzo, Ian, Keone & Mari, and Tony.",
"D. Tony, Ian, Kenzo, and Keone & Mari.",
"E. Keone & Mari, Ian, Tony, and Kenzo."
] |
A
|
I watched the video from the beginning and started collecting the names of the interviewees. I read their names across the screens that appeared on the left of them. At 00:41, Tony started the interviews and his name was displayed. At 01:45, the next interviewee, Kenzo, was shown with his name across the screen. At 02:51, the interviewee Ian Westwood was shown with his name across the screen. The last interviewees, Keone & Mari, were shown at 05:06 with their names across the screen. I noticed that before each interview the instructors performed. I obsereved they performed in the following order: Tony, Kenzo, Ian, and Keone and Mari.
|
medium
|
4n_mRf7j920
| 397 |
Short Films
|
What color shirt does the man who taught "Victory" wear?
|
[
"A. Peach.",
"B. Olive.",
"C. Charcoal.",
"D. Teal.",
"E. Cream."
] |
A
|
I watched the video and listened for anyone to mention teaching "Victory." This occurred at 05:17. I observed that the person who spoke "Victory" was a man and was accompanied by a woman. I observed the man's shirt and saw that it was a peach colored t-shirt.
|
medium
|
4n_mRf7j920
| 398 |
Short Films
|
How many interviewees had hats on?
|
[
"A. 5.",
"B. 4.",
"C. 2.",
"D. 1.",
"E. 3."
] |
B
|
I watched the video and identified each interviewee, and then counted how many of them had hats on. Tony was an interviewee, but he did not have a hat on. Kenzo had his hat on at 01:43. Ian had his hat on at 02:51. Lastly, Keone & Mari both had their hats on at 05:07. This added up to four interviewees having hats.
|
medium
|
4n_mRf7j920
| 399 |
Short Films
|
Where is the location when a crowd of dancers are dancing and the video is in slow motion?
|
[
"A. The dancers are in a large room dancing with a partner.",
"B. The dancers are in a large room facing a stage with two screens on both sides.",
"C. The dancers are in a large room walking in a circle.",
"D. The dancers are in a large room facing a stage with other dancers on stage.",
"E. The dancers are in a large room facing each other."
] |
B
|
I watched the video and from 03:51-03:55, I noticed that the video is in slow motion with the dancers facing the stage. They are in very large room with two large screens on both sides of the stage.
|
short
|
4n_mRf7j920
| 400 |
Short Films
|
What happens after the woman in the gold shirt wins the competition?
|
[
"A. She hugs the judges and leaves the stage.",
"B. She raises her hands and leaves the stage.",
"C. She grabs her face and leaves the stage.",
"D. She jumps in excitment and stays on the stage.",
"E. She grabs the trophy and stays on the stage."
] |
C
|
I scroll to the specified section of the video starting at 06:22, and I observe when the woman in the gold shirt wins her competition. At 06:23, she puts her face in her hands and proceeds to walk off of the stage.
|
medium
|
5-otljNyRmQ
| 401 |
Short Films
|
How many darts are thrown in the first scene?
|
[
"A. 6.",
"B. 2.",
"C. 4.",
"D. 3.",
"E. 8."
] |
C
|
I watched the video to identify the first scene. It begins at 00:03 after the title of the video is shown. At this time, a dart is immediately thrown. Another dart is thrown at 00:06. A third dart is thrown at 00:11 offscreen. We know this because he only has one dart left in his hand and we can hear it. At 00:20, a fourth dart is thrown. The scene ends at 01:06, with no other darts thrown in that time. So, the answer is 4.
|
medium
|
5-otljNyRmQ
| 402 |
Short Films
|
Which person is accused of being a kidnapper by the man in the light gray jacket?
|
[
"A. The man with the backwards baseball cap.",
"B. The man wearing glasses.",
"C. The man wearing a blonde wig.",
"D. The man in the orange puff jacket.",
"E. The man in the plaid shirt."
] |
D
|
I watched and listened to the scene where the man in the light gray jacket accuses one of the friends of kidnapping him, and points at that person, from 02:57-02:59. I then watched the next shot, in which it is made clear by his reaction from 03:00-03:02 that the man in the orange puff jacket was the one being pointed at.
|
medium
|
5-otljNyRmQ
| 403 |
Short Films
|
In what direction is the driver looking when he says he just saw Dave walking into the woods?
|
[
"A. In front of him.",
"B. To his right.",
"C. To his left.",
"D. Down.",
"E. Behind him."
] |
C
|
I listened for when the driver identified someone entering the woods. This occurs at 00:41. I then observed which direction he was looking and identified it as his left, out his driver's side window.
|
short
|
5-otljNyRmQ
| 404 |
Short Films
|
What happens after the friends exit the vehicle in the rain?
|
[
"A. Someone slams a car door.",
"B. Someone shoots a gun at the friends standing in front of the car.",
"C. Someone appears holding a lantern.",
"D. Someone cocks their rifle.",
"E. Someone slips and falls on the wet terrain."
] |
C
|
I watched the video and scrolled to the 01:52 time stamp. At this time, I see all four of the friends exit their vehicle as rain comes down outside. At 02:02, immediately after the previous scene concludes, a blonde man appears holding a lantern.
|
medium
|
5-otljNyRmQ
| 405 |
Short Films
|
What is the man at 00:06 doing?
|
[
"A. Playing cards.",
"B. Swilling beer.",
"C. Tinkering in his garage.",
"D. Playing ping pong.",
"E. Playing darts."
] |
E
|
At the 00:06 mark, I can see the man in a garage looking setting as he throws a dart at a dart board. Clearly, he is playing darts.
|
short
|
5Jrv1h4AztM
| 406 |
Animals
|
During the 6th shot of the boat at sea, how many people would be at the stern of the boat if there were an additional person helping the person in a collared striped shirt?
|
[
"A. 4.",
"B. 6.",
"C. 2.",
"D. 3.",
"E. 5."
] |
C
|
I found that the boat at sea first appears at 02:53. I began counting each shot. The next shot happens at 02:57, then 03:00, 03:14, 03:18, and finally, the sixth shot happens at 03:22. I watched this shot carefully and observed the orientation of the boat and the number of people around the boat. I saw that there were two people at the stern of the boat. I found the man in the striped shirt standing at the side of the boat with two others helping him at 03:26. If an additional person helped the person in the striped shirt, there would still be two people at the stern of the boat.
|
medium
|
5Jrv1h4AztM
| 407 |
Animals
|
What is the difference between the time it took for the first animal shown in the video to appear again and the duration of the end credits?
|
[
"A. 4.",
"B. 3.",
"C. 6.",
"D. 5.",
"E. 2."
] |
A
|
I identified the first animal at 00:11, a bird with a large black and yellow beak. The shot ends at 00:18. I continued watching the video until the bird appeared again. The bird appeared again at 01:06. To find out how long it took for the bird to appear again, I subtracted the duration where it was last seen, 18 seconds, from the duration when the bird reappeared, 01:06. This results in 00:48 seconds. I then found the beginning of the end credits at 16:47. I watched until the credits ended at 17:09. To find the duration of the end credits, I subtracted the duration 16:47 from 17:09. This results in 22 seconds. The difference between 18 seconds and 22 seconds is 4 seconds.
|
medium
|
5Jrv1h4AztM
| 408 |
Animals
|
There is a man left holding the crab after a rope has been tied around it; how many shots of fish being cut are seen before he is seen again?
|
[
"A. 2.",
"B. 1.",
"C. 0.",
"D. 4.",
"E. 3."
] |
B
|
I watched the video looking for a crab being tied up with rope, which begins at 10:54. Another man, wearing a green striped shirt, begins helping him at 11:00, and the crab is passed to this man at 11:05. I continued watching, and the next shot, beginning at 11:10, shows hands cutting fish. The shot after that begins at 11:14, and shows a hand holding chunks of fish. The next shot begins at 11:15, and the man wearing the green striped shirt is seen again. There has been 1 shot of fish being cut since the rope-tying shot.
|
medium
|
5Jrv1h4AztM
| 409 |
Animals
|
After the third insect is shown, how many shots happened until two birds appeared on sticks?
|
[
"A. 3.",
"B. 6.",
"C. 4.",
"D. 5.",
"E. 7."
] |
C
|
I began counting the appearance of insects at 00:43, when I first spotted an insect. I counted the second insect at 00:44. I counted the third insect at 00:46. I then began to count the number of shots that followed. The next shot begins at 00:47, then 00:49, 00:50, and finally, 00:52. I stopped counting at 00:52 because I noticed the two birds at 00:54. This totals 4 shots before the shot of the birds appeared.
|
medium
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.