text
stringlengths 105
4.44k
| label
int64 0
9
| label_text
stringclasses 10
values |
|---|---|---|
This reaction shows the oxidation of p-cresol in a sulfate-enriched environment. P-cresol was seen to be the easiest to degrade through the sulfate-enriched environment, while m-cresol and o-cresol where inhibited. In the chart above, p-cresol was oxidized under an anaerobic sulfate reducing condition and formed four different intermediates. After the formation of the intermediates, the study reported further degradation of the intermediates leading to the production of carbon dioxide and methane. The p-hydroxylbenzyl alcohol, p-hydroxylbenzaldehye, p-hyrdoxylbenzoate, and benzoate intermediates all are produced from this oxidation and released into the sediments. Similar results were also produced by different studies using other forms of oxidation such as: iron-reducing organisms, Copper/Manganese Oxide catalyst, and nitrate- reducing conditions. | 7 | Physical Chemistry |
Flashover is one of the most feared phenomena among firefighters. Firefighters are taught to recognize the signs of imminent rollovers and flashovers and to avoid backdrafts. For example, there are certain routines for opening closed doors to buildings and compartments on fire, known as door entry procedures, ensuring fire crew safety where possible. | 7 | Physical Chemistry |
In exceptionally preserved fossils, such as those of the Burgess shale, soft parts of organisms may be preserved. Since these fossils are often compressed into a planar film, it can be difficult to distinguish the features: a famous example is the triangular extensions in Opabinia, which were interpreted as either legs or extensions of the gut. Elemental mapping showed that their composition was similar to the gut, favoring that interpretation. Because of the thinness of carbon films, only low voltages (5-15 kV) can be used on them. | 3 | Analytical Chemistry |
The International Standard for making artificial seawater can be found at ASTM International. The current standard is named ASTM D1141-98 (The original standard was ASTM D1141-52) and describes the standard practice for the preparation of substitute ocean water.
The ASTM D1141-98 standard comes in a ready-made artificial seawater form or a "Sea Salt" mix that can be prepared by engineers and hobbyists. Generally, the ready-made artificial seawater comes in 1 gallon and 5 gallon containers, whereas the "Sea Salt" mix comes in 20lb pails (makes approximately 57 gallons) and 50lb pails (makes approximately 143 gallons). | 9 | Geochemistry |
"Polarity" is a gene expression mechanism in which transcription terminates prematurely due to a loss of coupling between transcription and translation. Transcription outpaces translation when the ribosome pauses or encounters a premature stop codon. This allows the transcription termination factor Rho to bind the mRNA and terminate mRNA synthesis. Consequently, genes that are downstream in the operon are not transcribed, and therefore not expressed. Polarity serves as mRNA quality control, allowing unused transcripts to be terminated prematurely, rather than synthesized and degraded.
The term "polarity" was introduced to describe the observation that the order of genes within an operon is important: a nonsense mutation within an upstream gene effects the transcription of downstream genes. Furthermore, the position of the nonsense mutation within the upstream gene modulates the "degree of polarity", with nonsense mutations at the start of the upstream genes exerting stronger polarity (more reduced transcription) on downstream genes.
Unlike the mechanism of attenuation, which involves intrinsic termination of transcription at well-defined programmed sites, polarity is Rho-dependent and termination occurs at variable position. | 1 | Biochemistry |
* O. K. Berdiev
* I. N. Khlopin
* Boris Kuftin
* Gorislava Nikolaevna Lisit︠s︡yna
* Mikhail Evgenievich Masson
* Vadim Mikhailovich Masson
* G. E. Markov
* Alexey Okladnikov
* Viktor Sarianidi | 8 | Metallurgy |
Neuraminidase inhibitors are useful for combating influenza infection: zanamivir, administered by inhalation; oseltamivir, administered orally; peramivir administered parenterally, that is through intravenous or intramuscular injection; and laninamivir which is in phase III clinical trials.
There are two major proteins on the surface of influenza virus particles. One is the lectin haemagglutinin protein with three relatively shallow sialic acid-binding sites and the other is enzyme sialidase with the active site in a pocket. Because of the relative deep active site in which low-molecular-weight inhibitors can make multiple favorable interactions and approachable methods of designing transition-state analogues in the hydrolysis of sialosides, the sialidase becomes more attractive anti-influenza drug target than the haemagglutinin. After the X-ray crystal structures of several influenza virus sialidases were available, the structure-based inhibitor design was applied to discover potent inhibitors of this enzyme.
The unsaturated sialic acid (N-acetylneuraminic acid [Neu5ac]) derivative 2-deoxy-2, 3-didehydro--N-acetylneuraminic acid (Neu5Ac2en), a sialosyl cation transition-state (Figure 2) analogue, is believed the most potent inhibitor core template. Structurally modified Neu5Ac2en derivatives may give more effective inhibitors.
Many Neu5Ac2en-based compounds have been synthesized and tested for their influenza virus sialidase inhibitory potential. For example:
The 4-substituted Neu5Ac2en derivatives (Figure 3), 4-amino-Neu5Ac2en (Compound 1), which showed two orders of magnitude better inhibition of influenza virus sialidase than Neu5Ac2en5 and 4-guanidino-Neu5Ac2en (Compound 2), known as Zanamivir, which is now marketed for treatment of influenza virus as a drug, have been designed by von Itzstein and coworkers. A series of amide-linked C9 modified Neu5Ac2en have been reported by Megesh and colleagues as NEU1 inhibitors. | 0 | Organic Chemistry |
In 1938, he married Irja Pullman; they had two daughters: Siiri Anna (b. 1939) and Jean Kirsten (b. 1944). In 1946, he married Eudoxia Muller, an artist and technician whom he met at the Polaroid Corp. This marriage, which lasted until 1972, produced a daughter, and a son: Crystal Elisabeth (b. 1947), and Eric Richard Arthur (b. 1953). | 4 | Stereochemistry |
The thermal expansion coefficients depends on the modification of zirconia as follows:
* Monoclinic: 7·10/K
* Tetragonal: 12·10/K
* YO stabilized: 10,5·10/K | 7 | Physical Chemistry |
An MPS gas is a mixture of two or more of propane, butane, butadiene, methylacetylene (propyne, CHC≡CH) and propadiene (CH=C=CH). They are marketed under different names including: "MPS", "Chem-O-Lean", "Apachi Gas", "FG-2 Gas", "Flamex" and "natural gas". The most commonly known type of MPS gas is the discontinued MAPP gas.
As a fuel gas, it burns hotter than propylene, propane or natural gas. | 0 | Organic Chemistry |
The partition coefficient, abbreviated P, is defined as a particular ratio of the concentrations of a solute between the two solvents (a biphase of liquid phases), specifically for un-ionized solutes, and the logarithm of the ratio is thus log P. When one of the solvents is water and the other is a non-polar solvent, then the log P value is a measure of lipophilicity or hydrophobicity. The defined precedent is for the lipophilic and hydrophilic phase types to always be in the numerator and denominator respectively; for example, in a biphasic system of n-octanol (hereafter simply "octanol") and water:
To a first approximation, the non-polar phase in such experiments is usually dominated by the un-ionized form of the solute, which is electrically neutral, though this may not be true for the aqueous phase. To measure the partition coefficient of ionizable solutes, the pH of the aqueous phase is adjusted such that the predominant form of the compound in solution is the un-ionized, or its measurement at another pH of interest requires consideration of all species, un-ionized and ionized (see following).
A corresponding partition coefficient for ionizable compounds, abbreviated log P , is derived for cases where there are dominant ionized forms of the molecule, such that one must consider partition of all forms, ionized and un-ionized, between the two phases (as well as the interaction of the two equilibria, partition and ionization). M is used to indicate the number of ionized forms; for the -th form () the logarithm of the corresponding partition coefficient, , is defined in the same manner as for the un-ionized form. For instance, for an octanol–water partition, it is
To distinguish between this and the standard, un-ionized, partition coefficient, the un-ionized is often assigned the symbol log P, such that the indexed expression for ionized solutes becomes simply an extension of this, into the range of values . | 7 | Physical Chemistry |
In the electronics industry, octafluoropropane is mixed with oxygen and used as a plasma etching material for SiO layers in semiconductor applications, as oxides are selectively etched versus their metal substrates.
In medicine, octafluoropropane may compose the gas cores of microbubble contrast agents used in contrast-enhanced ultrasound. Octafluoropropane microbubbles reflect sound waves well and are used to improve the ultrasound signal backscatter.
It is used in eye surgery, such as pars plana vitrectomy procedures where a retina hole or tear is repaired. The gas provides a long-term tamponade, or plug, of a retinal hole or tear and allows re-attachment of the retina to occur over the several days following the procedure.
Under the name R-218, octafluoropropane is used in other industries as a component of refrigeration mixtures.
It has been featured in some plans for terraforming Mars. With a greenhouse gas effect 24,000 times greater than carbon dioxide (CO), octafluoropropane could dramatically reduce the time and resources it takes to terraform Mars.
It is the active liquid in PICO-2L dark matter bubble detector (joined PICASSO and COUPP collaborations). | 2 | Environmental Chemistry |
Simulation and modeling techniques are often combined with experimental methods to characterize structures of amorphous materials. Commonly used computational techniques include density functional theory, molecular dynamics, and reverse Monte Carlo. | 7 | Physical Chemistry |
qPCR using reverse transcription (RT-qPCR) can be used to detect GMOs given its sensitivity and dynamic range in detecting DNA. Alternatives such as DNA or protein analysis are usually less sensitive. Specific primers are used that amplify not the transgene but the promoter, terminator or even intermediate sequences used during the process of engineering the vector. As the process of creating a transgenic plant normally leads to the insertion of more than one copy of the transgene its quantity is also commonly assessed. This is often carried out by relative quantification using a control gene from the treated species that is only present as a single copy. | 1 | Biochemistry |
In 1908, Lawrence Joseph Henderson derived an equation to calculate the hydrogen ion concentration of a bicarbonate buffer solution, which rearranged looks like this:
In 1909 Søren Peter Lauritz Sørensen introduced the pH terminology, which allowed Karl Albert Hasselbalch to re-express Henderson's equation in logarithmic terms, resulting in the Henderson–Hasselbalch equation. | 7 | Physical Chemistry |
There have been several efforts to map eukaryotic interactomes through HTP methods. While no biological interactomes have been fully characterized, over 90% of proteins in Saccharomyces cerevisiae have been screened and their interactions characterized, making it the best-characterized interactome. Species whose interactomes have been studied in some detail include
* Schizosaccharomyces pombe
* Caenorhabditis elegans
* Drosophila melanogaster
* Homo sapiens
Recently, the pathogen-host interactomes of Hepatitis C Virus/Human (2008), Epstein Barr virus/Human (2008), Influenza virus/Human (2009) were delineated through HTP to identify essential molecular components for pathogens and for their host's immune system. | 1 | Biochemistry |
A novel myokine osteonectin, or SPARC (secreted protein acidic and rich in cysteine), plays a vital role in bone mineralization, cell-matrix interactions, and collagen binding. Osteonectin inhibits tumorigenesis in mice. Osteonectin can be classed as a myokine, as it was found that even a single bout of exercise increased its expression and secretion in skeletal muscle in both mice and humans. | 1 | Biochemistry |
The United States Environmental Protection Agency has set a maximum contaminant level for benzene in drinking water at 0.0005 mg/L (5 ppb), as promulgated via the U.S. National Primary Drinking Water Regulations. This regulation is based on preventing benzene leukemogenesis. The maximum contaminant level goal (MCLG), a nonenforceable health goal that would allow an adequate margin of safety for the prevention of adverse effects, is zero benzene concentration in drinking water. The EPA requires that spills or accidental releases into the environment of 10 pounds (4.5 kg) or more of benzene be reported.
The U.S. Occupational Safety and Health Administration (OSHA) has set a permissible exposure limit of 1 part of benzene per million parts of air (1 ppm) in the workplace during an 8-hour workday, 40-hour workweek. The short term exposure limit for airborne benzene is 5 ppm for 15 minutes. These legal limits were based on studies demonstrating compelling evidence of health risk to workers exposed to benzene. The risk from exposure to 1 ppm for a working lifetime has been estimated as 5 excess leukemia deaths per 1,000 employees exposed. (This estimate assumes no threshold for benzene's carcinogenic effects.) OSHA has also established an action level of 0.5 ppm to encourage even lower exposures in the workplace.
The U.S. National Institute for Occupational Safety and Health (NIOSH) revised the Immediately Dangerous to Life and Health (IDLH) concentration for benzene to 500 ppm. The current NIOSH definition for an IDLH condition, as given in the NIOSH Respirator Selection Logic, is one that poses a threat of exposure to airborne contaminants when that exposure is likely to cause death or immediate or delayed permanent adverse health effects or prevent escape from such an environment. The purpose of establishing an IDLH value is (1) to ensure that the worker can escape from a given contaminated environment in the event of failure of the respiratory protection equipment and (2) is considered a maximum level above which only a highly reliable breathing apparatus providing maximum worker protection is permitted. In September 1995, NIOSH issued a new policy for developing recommended exposure limits (RELs) for substances, including carcinogens. As benzene can cause cancer, NIOSH recommends that all workers wear special breathing equipment when they are likely to be exposed to benzene at levels exceeding the REL (10-hour) of 0.1 ppm. The NIOSH short-term exposure limit (STEL – 15 min) is 1 ppm.
American Conference of Governmental Industrial Hygienists (ACGIH) adopted Threshold Limit Values (TLVs) for benzene at 0.5 ppm TWA and 2.5 ppm STEL. | 2 | Environmental Chemistry |
Viaspan was the trademark under which the University of Wisconsin cold storage solution (also known as University of Wisconsin solution or UW solution) was sold. Currently, UW solution is sold under the Belzer UW trademark and others like Bel-Gen or StoreProtect. UW solution was the first solution designed for use in organ transplantation, and became the first intracellular-like preservation medium. Developed in the late 1980s by Folkert Belzer and James Southard for pancreas preservation, the solution soon displaced EuroCollins solution as the preferred medium for cold storage of livers and kidneys, as well as pancreas. The solution has also been used for hearts and other organs. University of Wisconsin cold storage solution remains what is often called the gold standard for organ preservation, despite the development of other solutions that are in some respects superior. | 1 | Biochemistry |
3-Iodophenol (m-iodophenol) is an aromatic organic compound. 3-Iodophenol participates in a variety of coupling reactions in which the iodide substituent is displaced. Well cited examples include thiolate and amine nucleophiles.
3-Iodophenol can be prepared by oxidative decarboxylation of 3-iodobenzoic acid: | 0 | Organic Chemistry |
In 2009, researchers developed siRNAs capable of targeting both polo-like kinase 1(PLK1) and kinesin spindle protein(KSP). Both proteins are important to the cell-cycle of tumor cells, PLK1 involved with phosphorylation of a variety of proteins and KSP integral to chromosome segregation during mitosis. Specifically, bipolar mitotic spindles are unable to form when KSP is inhibited, leading to arrest of the cell cycle and, eventually, apoptosis. Likewise, inhibition of PLK1 facilitates mitotic arrests and cell apoptosis. According to the study, a 2 mg/kg dose of PLK1-specific siRNA administered for 3 weeks to mice implanted with tumors resulted in increased survival times and obvious reduction of tumors. In fact, the median survival time of treated mice was 51 days as opposed to 32 days for the controls. Further, only 2 of the 6 mice treated had noticeable tumors around the implantation site. Even so, GAPDH, a tumor-derived signal, was present at low levels, indicating significant suppression of tumor growth but not complete elimination. Still, the results suggested minimal toxicity and no significant dysfunction of the bone marrow. Animals treated with KSP-specific siRNA, too, exhibited increased survival times of 28 days compared to 20 days in the controls. | 1 | Biochemistry |
In 1954, research into the chemistry of ferrocene began at the Department of Organic Chemistry at Moscow State University and at INEOS under the direction of Nesmeyanov. It turned out that the functional derivatives of ferrocene react similarly to aromatic compounds. However, it has been shown that the electronic effects of the substituents are transmitted through the metallocene core by an inductive mechanism, and therefore have a lesser effect than on benzene derivatives. Research on ferrocene and its derivatives made it possible to create a number of photosensitive compositions that allow obtaining a stable image on paper, fabric, plastics and metals, and also led to the creation of a new drug, ferrocerone, which fights diseases associated with iron deficiency. On the basis of cymantrene, Nesmeyanov proposed a new antiknock agent for motor gasoline. | 0 | Organic Chemistry |
Kinetic fractionation of dissolved iron occurs as a result of diffusion. When isotopes diffuse, the lower mass isotopes diffuse more quickly than the heavier isotopes, resulting in fractionation. This difference in diffusion rates has been approximated as:
In this equation, D and D are the diffusivities of the isotopes, m and m are the masses of the isotopes, and β, which can vary between 0 and 0.5, depending on the system. More work is required to fully understand fractionation as a result of diffusion, studies of diffusion of iron on metal have consistently given β values of approximately 0.25. Iron diffusion between silicate melts and basaltic/rhyolitic melts have given lower β values (~0.030). In aqueous environments, a β value of 0.0025 has been obtained. | 9 | Geochemistry |
TPVs can provide continuous power to off-grid homes. Traditional PVs do not provide power during winter months and nighttime, while TPVs can utilize alternative fuels to augment solar-only production.
The greatest advantage for TPV generators is cogeneration of heat and power. In cold climates, it can function as both a heater/stove and a power generator. JX Crystals developed a prototype TPV heating stove/generator that burns natural gas and uses a SiC source emitter operating at 1250 °C and GaSb photocell to output 25,000 BTU/hr (7.3kW of heat) simultaneously generating 100W (1.4% efficiency). However, costs render it impractical.
Combining a heater and a generator is called combined heat and power (CHP). Many TPV CHP scenarios have been theorized, but a study found that generator using boiling coolant was most cost efficient. The proposed CHP would utilize a SiC IR emitter operating at 1425 °C and GaSb photocells cooled by boiling coolant. The TPV CHP would output 85,000 BTU/hr (25kW of heat) and generate 1.5 kW. The estimated efficiency would be 12.3% (?)(1.5kW/25kW = 0.06 = 6%) requiring investment or 0.08 €/kWh assuming a 20 year lifetime. The estimated cost of other non-TPV CHPs are 0.12 €/kWh for gas engine CHP and 0.16 €/kWh for fuel cell CHP. This furnace was not commercialized because the market was not thought to be large enough. | 7 | Physical Chemistry |
Energy accounting is a system used in energy management systems to measure and analyze energy consumption to improve energy efficiency within an organization. Organisations such as Intel corporation use these systems to track energy usage.
Various energy transformations are possible. An energy balance can be used to track energy through a system. This becomes a useful tool for determining resource use and environmental impacts. How much energy is needed at each point in a system is measured, as well as the form of that energy. An accounting system keeps track of energy in, energy out, and non-useful energy versus work done, and transformations within a system. Sometimes, non-useful work is what is often responsible for environmental problems. | 7 | Physical Chemistry |
The most common method to calculate the surface stresses is by calculating the surface free energy and its derivative with respect to elastic strain. Different methods have been used such as first principles, atomistic potential calculations and molecular dynamics simulations, with density functional theory most common. A large tabulation of calculated values for metals has been given by Lee et al. Typical values of the surface energies are 1-2 Joule per metre squared (), with the trace of the surface stress tensor in the range of -1 to 1 . Some metals such as aluminum are calculated to have fairly high, positive values (e.g. 0.82) indicating a strong propensity to contract, whereas others such as calcium are quite negative at -1.25, and others are close to zero such as cesium (-0.02). | 7 | Physical Chemistry |
Grotthuss was born in 1785 in Leipzig, Electorate of Saxony, Holy Roman Empire, during an extended stay of his parents away from their home in northern Grand Duchy of Lithuania. He showed interest in natural sciences and went to study first in Leipzig and later in Paris at the École Polytechnique. Several renowned scientists taught at the École Polytechnique at that time, including Antoine François, comte de Fourcroy, Claude Louis Berthollet and Louis Nicolas Vauquelin.
Because of some tensions in the relations between Russia and France, Grotthuss had to leave for Italy where he stayed at Naples for one year. The discovery of the first electric cell in 1800 by Alessandro Volta provided the scientists a source of electricity which was used in various laboratory experiments around Europe. The electrolysis of water, acids and salt solutions was reported, but a good explanation was missing. Grotthuss actively contributed to this area both in terms of electrolysis experiments and their interpretation. During his stay in Italy, he published his work on electrolysis in 1806. His idea that the charge is not transported by the movement of particles but by breaking and reformation of bonds was the first basically correct concept for the charge transport in electrolytes; it is still valid for the charge transport in water, and the current proton hopping mechanism is a modified version of the original Grotthuss mechanism.
The following two years Grotthuss spent in Rome, some other Italian cities, and Paris, and then went back to Russia via Munich and Vienna. From 1808 on he lived at the estate of his mother in northern Lithuania. There he conducted research on electricity and light with the limited research equipment he could assemble. Grotthuss committed suicide in the spring of 1822 during a depression caused by health problems. | 5 | Photochemistry |
4-Hydroxyestradiol (4-OHE2), also known as estra-1,3,5(10)-triene-3,4,17β-triol, is an endogenous, naturally occurring catechol estrogen and a minor metabolite of estradiol. It is estrogenic, similarly to many other hydroxylated estrogen metabolites such as 2-hydroxyestradiol, 16α-hydroxyestrone, estriol (16α-hydroxyestradiol), and 4-hydroxyestrone but unlike 2-hydroxyestrone. | 1 | Biochemistry |
In coordination chemistry, a transition metal NHC complex is a metal complex containing one or more N-heterocyclic carbene ligands. Such compounds are the subject of much research, in part because of prospective applications in homogeneous catalysis. One such success is the second generation Grubbs catalyst.
Historically, N-heterocyclic carbenes were thought to mimic properties of tertiary phosphines. Many steric and electronic differences exist between the two ligands. Compared to phosphine ligands, NHC ligands' cone angle is more complex. The imidazole ring of the NHC ligand is angled away from the metal center, yet the substituents at the 1,3 positions of the imidazole ring are angled towards it. The presence of the ligand inside of the metal coordination sphere affects the metal reactivity. In terms of electronic effects, NHC are often stronger sigma donation. | 0 | Organic Chemistry |
Modern lacUV5 is seen in the BL21(DE3) strain, which carries both a lac operon with the standard promoter and a lacUV5 operon split by the DE3 prophage (and as a result driving the T7 RNA polymerase instead). The two important mutations are underlined.
lacUV5 TCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT
LacZ TCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATTGTGTGAAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT
position ^-35 ^-10 ^+1 | 1 | Biochemistry |
The phenomenon of limited cellular division was first observed by Leonard Hayflick, and is now referred to as the Hayflick limit. Significant discoveries were subsequently made by a group of scientists organized at Geron Corporation by Gerons founder Michael D. West, that tied telomere shortening with the Hayflick limit. The cloning of the catalytic component of telomerase enabled experiments to test whether the expression of telomerase at levels sufficient to prevent telomere shortening was capable of immortalizing human cells. Telomerase was demonstrated in a 1998 publication in Science' to be capable of extending cell lifespan, and now is well-recognized as capable of immortalizing human somatic cells.
Two studies on long-lived seabirds demonstrate that the role of telomeres is far from being understood. In 2003, scientists observed that the telomeres of Leachs storm-petrel (Oceanodroma leucorhoa') seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres.
A study reported that telomere length of different mammalian species correlates inversely rather than directly with lifespan, and concluded that the contribution of telomere length to lifespan remains controversial. There is little evidence that, in humans, telomere length is a significant biomarker of normal aging with respect to important cognitive and physical abilities. | 1 | Biochemistry |
SOFIA comprises a multiwell plate sample container, an automated means for successively transporting samples from the multiwell plate sample container to a transparent capillary contained within a sample holder, an excitation source in optical communication with the sample, wherein radiation from the excitation source is directed along the length of the capillary, and wherein the radiation induces a signal which is emitted from the sample, and, at least one linear array. | 1 | Biochemistry |
The galvanic series (or electropotential series) determines the nobility of metals and semi-metals. When two metals are submerged in an electrolyte, while also electrically connected by some external conductor, the less noble (base) will experience galvanic corrosion. The rate of corrosion is determined by the electrolyte, the difference in nobility, and the relative areas of the anode and cathode exposed to the electrolyte. The difference can be measured as a difference in voltage potential: the less noble metal is the one with a lower (that is, more negative) electrode potential than the nobler one, and will function as the anode (electron or anion attractor) within the electrolyte device functioning as described above (a galvanic cell). Galvanic reaction is the principle upon which batteries are based.
See the table of standard electrode potentials for more details. | 8 | Metallurgy |
In vitro transcription (IVT) is performed on a linearized DNA plasmid template containing the targeted coding sequence. Then, naked mRNA or mRNA complexed in a nanoparticle will be delivered systemically or locally. Subsequently, a part of the exogenous naked mRNA or complexed mRNA will go through cell-specific mechanisms. Once in the cytoplasm, the IVT mRNA is translated by the protein synthesis machinery.
There are two identified RNA sensors, toll-like receptors (TLRs) and the RIG-I-like receptor family. TLRs are localized in the endosomal compartment of cells, such as DCs and macrophages. RIG-I-like family is as a pattern recognition receptor (PRR). However, the immune response mechanisms and process of mRNA vaccine recognition by cellular sensors and the mechanism of sensor activation are still unclear. | 1 | Biochemistry |
* X-ray photoelectron spectroscopy
* Auger electron spectroscopy
* Electron energy loss spectroscopy
* Ultraviolet photoelectron spectroscopy | 7 | Physical Chemistry |
Copepods are assigned to the class Copepoda within the superclass Multicrustacea in the subphylum Crustacea. An alternative treatment is as a subclass belonging to class Hexanauplia. They are divided into 10 orders. Some 13,000 species of copepods are known, and 2,800 of them live in fresh water. | 2 | Environmental Chemistry |
* High energy costs currently associated with generating and transporting hydrogen offsite.
* Presently generated from natural gas still dependent on fossil fuels (although any combustible hydrocarbon can be used).
* Production from biomass is highly land-intensive
* Energy density (by weight or volume) one half of that of gasoline and 24% less than ethanol
* Handling
** If no inhibitors are used, methanol is corrosive to some common metals including aluminum, zinc and manganese. Parts of the engine fuel-intake systems are made from aluminum. Similar to ethanol, compatible material for fuel tanks, gasket and engine intake have to be used.
** As with similarly corrosive and hydrophilic ethanol, existing pipelines designed for petroleum products cannot handle methanol. Thus methanol requires shipment at higher energy cost in trucks and trains, until new pipeline infrastructure can be built, or existing pipelines are retrofitted for methanol transport.
** Methanol, as an alcohol, increases the permeability of some plastics to fuel vapors (e.g. high-density polyethylene). This property of methanol has the possibility of increasing emissions of volatile organic compounds (VOCs) from fuel, which contributes to increased tropospheric ozone and possibly human exposure.
* Low volatility in cold weather: pure methanol-fueled engines can be difficult to start, and they run inefficiently until warmed up. This is why a mixture containing 85% methanol and 15% gasoline called M85 is generally used in ICEs. The gasoline allows the engine to start even at lower temperatures.
* With the exception of low level exposure, methanol is toxic. Methanol is lethal when ingested in larger amounts (30 to 100 mL). But so are most motor fuels, including gasoline (120 to 300 mL) and diesel fuel. Gasoline also contains small amounts of many compounds known to be carcinogenic (e.g. benzene). Methanol is not a carcinogen, nor does it contain carcinogens. However, methanol may be metabolized in the body to formaldehyde, which is both toxic and carcinogenic. Methanol occurs naturally in small quantities in the human body and in edible fruits.
* Methanol is a liquid: this creates a greater fire risk compared to hydrogen in open spaces as Methanol leaks do not dissipate. Methanol burns invisibly unlike gasoline. Compared to gasoline, however, methanol is much safer. It is more difficult to ignite and releases less heat when it burns. Methanol fires can be extinguished with plain water, whereas gasoline floats on water and continues to burn. The EPA has estimated that switching fuels from gasoline to methanol would reduce the incidence of fuel related fires by 90%. | 2 | Environmental Chemistry |
Many metal alkoxide compounds also feature oxo-ligands. Oxo-ligands typically arise via the hydrolysis, often accidentally, and via ether elimination: | 0 | Organic Chemistry |
He was born in Moscow. He had two brothers Vasily (1904) and Andrei (1911) and a sister Tatyana (1908) (two born sisters died in infancy). His father (Nikolai Vasilyevich Nesmeyanov), graduated with excellence Vladimir Gymnasium, and then the Faculty of Law of Moscow University. He became interested in enlightenment and was working as a public teacher in the village of Bushov (Tula province) for 10 years. He had married in 1898 and worked at the Moscow city government, then he was a director Bakhrushinsky orphanage in Moscow (1901 – 1917). Alexander's mother, Lyudmila Danilovna (1878 – 1958), was a multi-talented teacher. At ten years Alexander became a vegetarian, and in 1913 he stopped eating fish. It was not easy to follow this conviction, especially in the famine years of 1918 – 1921, when roach and herring were an essential food product. He had become interested in various branches of biology: entomology, hydrobiology, ornithology and from the age of thirteen became interested in chemistry. | 0 | Organic Chemistry |
To show the visitors how Birminghams iron industry developed, the main museum displays a wide range of Tannehill artifacts that have survived. Visitors, through paying a visit to the museum, can learn from the graphic exhibits how iron was made by 13 different iron companies and six rolling mills and how Alabamas iron-making industry made this state the arsenal of the Confederacy. Although Alabamas iron and steel industry experienced rapid growth during the post-war decades, Alabamas iron production had already occupied a central position in the countrys iron supply before the war ended. In the last two years of the Civil war, iron produced by Alabama furnaces accounted for 70% of the Confederate iron supply. To demonstrate the significant role Alabama played during the war , the museum displays a large number of wartime ironworks, including cookware, rifles and other weapons used by US soldiers (e.g. a 52 Cal. U.S. Spencer Repeater), cast-iron water pipes, CS artillery projectiles, the original parts of the Six Mile Bloomery Forge manufactured in 1860s, as well as a part of the Steve Phillips Collection. Notably, the artillery shells manufactured from 1862 to 1865 at the Naval Gun Works are also preserved in this museum, and this exhibition is considered as the Souths largest collection of artillery shells. In addition to the wartime iron relics, the museum preserves and demonstrates substantial numbers of historical artifacts that have witnessed the development of Alabama's iron and steel industry, such as a cast iron water pipe made in Birmingham during the 1880s.
The Iron and Steel Museum of Alabama not only displays iron relics but also preserves archaeological artifacts uncovered in this region. The site houses Walter B. Jones Centre for Industrial Archaeology, a state geologist and archeologist who devoted his lifetime to investigating Alabamas mineral and fossil fuel resources (Garrison, 2001) His geological and archaeological works are well preserved by many museums and historical institutions, including the University of Alabamas Jones Museum at Moundville Archaeological Park, as well as the Iron and Steel Museum of Alabama. In addition to the preservation of the archaeological works written by Walter Jones, the museum is further famous for its conservation of more than 10,000 archaeological artifacts that were discovered from 8 major on-site archaeological investigations from 1956 to 2008. It is noteworthy that the main museum building also houses a small research library. In this library, those who are interested in investigating the iron-making history in this country (e.g. historical researchers, scholars, and students) can find many historical archives, published materials, records, as well as first-hand accounts. | 8 | Metallurgy |
During his life, Pigulevsky became the author of more than 200 publications. He was the author of several monographs, including:
"Essential oils"
"Formation and transformation of essential oils and resins in conifers"
"Chemistry of Terpenes" | 0 | Organic Chemistry |
Pol III is unusual (compared to Pol II) by requiring no control sequences upstream of the gene, instead normally relying on internal control sequences - sequences within the transcribed section of the gene (although upstream sequences are occasionally seen, e.g. U6 snRNA gene has an upstream TATA box as seen in Pol II Promoters).
There are three classes of Pol III initiation, corresponding to 5S rRNA, tRNA, and U6 snRNA initiation. In all cases, the process starts with transcription factors binding to control sequences and ends with TFIIIB (Transcription Factor for polymerase III B) being recruited to the complex and assembling Pol III. TFIIIB consists of three subunits: TATA binding protein (TBP), a TFIIB-related factor (BRF1, or BRF2 for transcription of a subset of Pol III-transcribed genes in vertebrates), and a B-double-prime (BDP1) unit. The overall architecture bears similarities to that of Pol II. | 1 | Biochemistry |
Stiction refers to the characteristic of start-and-stop–type motion of a mechanical assembly. Consider a mechanical element slowly increasing an external force on an assembly at rest that is designed for the relative rotation or sliding of its parts in contact. The static contact friction between the assembly parts resists movement, causing the spring moments in the assembly to store mechanical energy. Any part of the assembly that can elastically bend, even microscopically, and exert a restoring force contributes a spring moment. Thus the "springs" in an assembly might not be obvious to the eye. The increasing external force finally exceeds the static friction resisting force, the spring moments, released, impulsively exert their restoring forces on both the moving assembly parts and, Newton's Third Law, in reaction on the external forcing element. The assembly parts then impulsively accelerate in motion with respect to each other though resisted by dynamic contact friction (in this context very much less than the static friction). However, the forcing element cannot accelerate at the same pace, fails to keep up and loses contact. The external force on the moving assembly momentarily drops to zero for lack of forcing mechanical contact even though the external force element continues its motion. The moving part then decelerates to a stop from the dynamic contact friction. The cycle repeats as the forcing element motion catches up to contact again. Stick, store spring energy, impulsively release spring energy, accelerate, decelerate, stop, stick. Repeat.
Stiction is a problem for the design and materials science of many moving linkages. This is particularly the case for linear sliding joints, rather than rotating pivots. Owing to simple geometry, the moving distance of a sliding joint in two comparable linkages is longer than the circumferential travel of a pivoting bearing, thus the forces involved (for equivalent work) are lower and stiction forces become proportionally more significant. This issue has often led to linkages being redesigned from sliding to purely pivoted structures, just to avoid problems with stiction. An example is the Chapman strut, a suspension linkage. | 7 | Physical Chemistry |
Lactose synthase is an enzyme that generates lactose from glucose and UDP-galactose.
It is classified under .
It consists of N-acetyllactosamine synthase and alpha-lactalbumin. Alpha-lactalbumin, which is expressed in response to prolactin, increases the affinity of N-acetyllactosamine synthase for its substrate, causing increased production of lactose during lactation.
N-acetyllactosamine synthase falls under the category of beta-1,4-galactosyltransferase, a type-II membrane protein found in the Golgi. Alpha-lactalbumin is a Ca binding protein specific to mammary glands. Beta-1,4-galactosyltransferase consists of the catalytic component and alpha-lactalbumin consists of the regulatory component of lactose synthase. Alpha-lactalbumin promotes glucose binding to beta-1,4-galactosyltransferase. The beta-1,4-galactosyltransferase catalytic component consists of two flexible loops: small loop and large loop. The small loop consists of a Trp residue (Trp314) with surrounding glycine residues, meanwhile the large loop makes up amino acid residues 345 to 365. The Trp residue in the small loop moves allowing for the sugar nucleotide to be locked into the binding site. This causes a conformational change in the large loop which then creates sites for oligosaccharide and metal ion binding, and protein-protein interactions for alpha-lactalbumin. | 1 | Biochemistry |
Bürgi–Dunitz angle theory was initially developed based on "frozen" interactions in crystals, while most chemistry takes place via collisions of molecules tumbling in solution; remarkably, the theories of the , with the complexity they reflect, evolved not from crystallographic work, but from studying reaction outcomes in such practical reactions as addition of enolates to aldehydes (e.g., in study of diastereoselection in particular aldol reactions). In applying both angles of the nucleophile trajectory to real chemical reactions, the HOMO-LUMO centered view of the Bürgi-Dunitz angle, , is modified to include further complex, electrophile-specific attractive and repulsive electrostatic and van der Waals interactions that can alter and bias toward one substituent or the other (see above). As well, dynamics are at play in each system (e.g., changing torsional angles) and are implicitly included in studies of reaction outcomes in solution, as in the early studies of ,—though not in crystallographic structure correlation approaches as gave birth to the BD concept.
Finally, in constrained environments (e.g., in enzyme and nanomaterial binding sites), these angles, when characterized, appear to be quite distinct, an observation conjectured to arise because reactivity is not based on random collision, and so the relationship between orbital overlap principles and reactivity is more complex. For instance, while a simple amide addition study with relatively small substituents gave an of ≈50° in solution, the crystallographic value determined for an enzymatic cleavage of an amide by the serine protease subtilisin gave an of 8°, and a compilation of literature crystallographic values for the same reaction in different catalysts clustered at 4 ± 6° (i.e., only slightly offset from directly behind the carbonyl, despite significant dissymmetry of the substrate electrophiles). At the same time, the subtilisin was 88° (quite distinct from the hydride-formaldehyde value of 107°, see the Bürgi–Dunitz article), and angle values from the careful literature compilation clustered at 89 ± 7° (i.e., only slightly offset from directly above or below the carbonyl carbon). | 7 | Physical Chemistry |
Transfer RNAs, which are RNAs that participate in translation, contain the greatest number of modifications of any type of RNA, with up to one-fourth of the nucleosides in these molecules containing some sort of modification in eukaryotes. There are several known reasons for the wide variety of modifications found in tRNA. First of all, such modifications allow for easier differentiation between different tRNA molecules, such as separating the initiator tRNA from elongator tRNA. Moreover, they increase overall tRNA stability. Some studies have shown that the modifications of tRNA can be dynamic and adaptive to the changes of the environment. Examples include methylation of cytosine groups by tRNA methyltransferase (Trm4) in response to the depletion of nutrients in the body. The tRNA's cruciform structure is incredibly important to its overall function and such a complicated structure is maintained by post-transcriptional modifications. A primary example of this is the methylation of guanosine at junctions within the tRNA structure. These methylguanosine impact the overall tertiary structure by disrupting any potential canonical hydrogen bonding (hydrogen bonds that are conventional Watson-Crick base pairs), thus creating a loop at the core of the tRNA. Other modifications are integral for creating and maintaining the extreme bends in the structure. | 1 | Biochemistry |
Although the sequence of steps involved in the assembly of the PIC can vary, in general, they follow step 1, binding to the promoter.
# The TATA-binding protein (TBP, a subunit of TFIID), TBPL1, or TBPL2 can bind the promoter or TATA box. Most genes lack a TATA box and use an initiator element (Inr) or downstream core promoter instead. Nevertheless, TBP is always involved and is forced to bind without sequence specificity. TAFs from TFIID can also be involved when the TATA box is absent. A TFIID TAF will bind sequence specifically, and force the TBP to bind non-sequence specifically, bringing the remaining portions of TFIID to the promoter.
# TFIIA interacts with the TBP subunit of TFIID and aids in the binding of TBP to TATA-box containing promoter DNA. Although TFIIA does not recognize DNA itself, its interactions with TBP allow it to stabilize and facilitate formation of the PIC.
# The N-terminal domain of TFIIB brings the DNA into proper position for entry into the active site of RNA polymerase II. TFIIB binds partially sequence specifically, with some preference for BRE. The TFIID-TFIIA-TFIIB (DAB)-promoter complex subsequently recruits RNA polymerase II and TFIIF.
# TFIIF (two subunits, RAP30 and RAP74, showing some similarity to bacterial sigma factors) and Pol II enter the complex together. TFIIF helps to speed up the polymerization process.
# TFIIE joins the growing complex and recruits TFIIH. TFIIE may be involved in DNA melting at the promoter: it contains a zinc ribbon motif that can bind single-stranded DNA. TFIIE helps to open and close the Pol II’s Jaw-like structure, which enables movement down the DNA strand.
# DNA may be wrapped one complete turn around the preinitiation complex and it is TFIIF that helps keep this tight wrapping. In the process, the torsional strain on the DNA may aid in DNA melting at the promoter, forming the transcription bubble.
# TFIIH enters the complex. TFIIH is a large protein complex that contains among others the CDK7/cyclin H kinase complex and a DNA helicase. TFIIH has three functions: It binds specifically to the template strand to ensure that the correct strand of DNA is transcribed and melts or unwinds the DNA (ATP-dependent) to separate the two strands using its helicase activity. It has a kinase activity that phosphorylates the C-terminal domain (CTD) of Pol II at the amino acid serine. This switches the RNA polymerase to start producing RNA. Finally it is essential for Nucleotide Excision Repair (NER) of damaged DNA. TFIIH and TFIIE strongly interact with one another. TFIIE affects TFIIH's catalytic activity. Without TFIIE, TFIIH will not unwind the promoter.
# TFIIH helps create the transcription bubble and may be required for transcription if the DNA template is not already denatured or if it is supercoiled.
# Mediator then encases all the transcription factors and Pol II. It interacts with enhancers, areas very far away (upstream or downstream) that help regulate transcription.
The formation of the preinitiation complex (PIC) is analogous to the mechanism seen in bacterial initiation. In bacteria, the sigma factor recognizes and binds to the promoter sequence. In eukaryotes, the transcription factors perform this role. | 1 | Biochemistry |
Besides the polar lipids, the outer layer of MFGM contains a number of glycosylated and non-glycosylated proteins. Proteomic analysis has revealed at least 191 different known proteins in human MFGM, and comparable numbers in bovine milk protein concentrates. While quantitatively these only represent 1% to 2% of total milk protein content, MFGM proteins are of significant interest because many are known to have bioactive and potentially beneficial properties; almost half of identified proteins have membrane/protein trafficking or cell signaling functions. The glycosylated proteins, including mucins (MUC-1, MUC-4, MUC-15), butyrophilin, lactadherin, and CD36, have been suggested to enhance triacylglyceride digestion efficiency. Furthermore, lactadherin and MUC-1, in addition to the non-glycosylated protein xanthine oxidase, have been shown or suggested in preclinical studies to possess antimicrobial properties. | 1 | Biochemistry |
When excretion of bilirubin glucuronide by the kidney is detected in the urine through urine examination, meaning that a conspicuous amount of conjugated bilirubin is present and circulating in the blood. | 1 | Biochemistry |
Poly(3-hydroxybutyrate-co-3-hydroxyvalerate), commonly known as PHBV, is a polyhydroxyalkanoate-type polymer. It is biodegradable, nontoxic, biocompatible plastic produced naturally by bacteria and a good alternative for many non-biodegradable synthetic polymers. It is a thermoplastic linear aliphatic polyester. It is obtained by the copolymerization of 3-hydroxybutanoic acid and 3-hydroxypentanoic acid. PHBV is used in speciality packaging, orthopedic devices and in controlled release of drugs. PHBV undergoes bacterial degradation in the environment. | 1 | Biochemistry |
In a molecule, both the electrons and nuclei experience similar-scale forces from the Coulomb interaction. However, the nuclei remain at nearly fixed locations in the molecule while the electrons move significantly. This picture of a molecule is based on the idea that nucleons are much heavier than electrons, so will move much less in response to the same force. Neutron scattering experiments on molecules have been used to verify this description. | 7 | Physical Chemistry |
From the figure above, it can also be seen that the interaction between two consecutive AOs is attenuated by the incremental twisting between orbitals by , where is the angle of twisting between consecutive orbitals, compared to the usual Hückel system. For this reason resonance integral is given by
where is the standard Hückel resonance integral value (with completely parallel orbitals).
Nevertheless, after going all the way around, the Nth and 1st orbitals are almost completely out of phase. (If the twisting were to continue after the th orbital, the st orbital would be exactly phase-inverted compared to the 1st orbital). For this reason, in the Hückel matrix the resonance integral between carbon and is .<br />
For the generic carbon Möbius system, the Hamiltonian matrix is:
Eigenvalues for this matrix can now be found, which correspond to the energy levels of the Möbius system. Since is a matrix, we will have eigenvalues and MOs. Defining the variable
we have:
To find nontrivial solutions to this equation, we set the determinant of this matrix to zero to obtain
Hence, we find the energy levels for a cyclic system with Möbius topology,
In contrast, recall the energy levels for a cyclic system with Hückel topology, | 7 | Physical Chemistry |
Cell–cell interactions are highly specific and are tightly regulated. Genetic defects and dysregulation of these interactions can cause many different diseases. Dysregulation that leads to leukocyte migration into healthy tissues can cause conditions such as acute respiratory distress syndrome and some types of arthritis. The autoimmune disease pemphigus vulgaris results from autoantibodies to desmoglein and other normal body proteins. The autoantibodies disrupt the adhesion between epithelial cells. This causes blisters of the skin and mucous membranes. Mutations in the connexin genes cause 8 human diseases including heart malformations and neurosensory deafness. | 1 | Biochemistry |
The atmophile elements are H, C, N and the noble gases.
Atmophile elements (also called "volatile elements") are defined as those that remain mostly on or above the surface because they are, or occur in, liquids and/or gases at temperatures and pressures found on the surface. The noble gases do not form stable compounds and occur as monatomic gases, while nitrogen, although it does not have a stable configuration for its individual atoms, forms a diatomic molecule so strong that all oxides of nitrogen are thermodynamically unstable with respect to nitrogen and oxygen. Consequently, with the development of free oxygen through photosynthesis, ammonia was oxidised to molecular nitrogen which has come to form four-fifths of the Earths atmosphere. Carbon is also classed as an atmophile because it forms very strong multiple bonds with oxygen in carbon monoxide (slowly oxidised in the atmosphere) and carbon dioxide. The latter is the fourth-largest constituent of the Earths atmosphere, while carbon monoxide occurs naturally in volcanoes and has a residence time in the atmosphere of a few months.
Hydrogen, which occurs in the compound water, is also classed as an atmophile. Water is classified as a volatile, because most of it is liquid or gas, even though it does exist as a solid compound on the surface. Water can also be incorporated into other minerals as water of crystallization (e.g. gypsum) or as hydroxyl groups (e.g. talc), giving hydrogen some lithophile character.
Because all atmophile elements are either gases or form volatile hydrides, atmophile elements are strongly depleted on earth as a whole relative to their solar abundances owing to losses from the atmosphere during the formation of the Earth. The heavier noble gases (krypton, xenon) are the rarest stable elements on Earth. | 9 | Geochemistry |
The British Non-Ferrous Metals Research Association was a research group in the United Kingdom during the 20th century, bringing together public and privately funded research into metallurgy. The name was abbreviated officially to B.N.F.M.R.A. (the organisation was normally known as ‘The BNF’ during its life). It was formed in 1920 by members of the British Non-Ferrous Metals Federation which represented the commercial interests of British manufacturers of coppers and copper alloys, lead, zinc and other non-ferrous metals and their alloys, latterly including titanium. Robert Hutton was appointed director in 1921. | 8 | Metallurgy |
Molecular motors are natural (biological) or artificial molecular machines that are the essential agents of movement in living organisms. In general terms, a motor is a device that consumes energy in one form and converts it into motion or mechanical work; for example, many protein-based molecular motors harness the chemical free energy released by the hydrolysis of ATP in order to perform mechanical work. In terms of energetic efficiency, this type of motor can be superior to currently available man-made motors. One important difference between molecular motors and macroscopic motors is that molecular motors operate in the thermal bath, an environment in which the fluctuations due to thermal noise are significant. | 6 | Supramolecular Chemistry |
In vascular plant biology, electro-osmosis is also used as an alternative or supplemental explanation for the movement of polar liquids via the phloem that differs from the cohesion-tension theory supplied in the mass flow hypothesis and others, such as cytoplasmic streaming. Companion cells are involved in the "cyclic" withdrawal of ions (K) from sieve tubes, and their secretion parallel to their position of withdrawal between sieve plates, resulting in polarisation of sieve plate elements alongside potential difference in pressure, and results in polar water molecules and other solutes present moved upward through the phloem.
In 2003, St Petersburg University graduates applied direct electric current to 10 mm segments of mesocotyls of maize seedlings alongside one-year linden shoots; electrolyte solutions present in the tissues moved toward the cathode that was in place, suggesting that electro-osmosis might play a role in solution transport through conductive plant tissues. | 7 | Physical Chemistry |
Aldehyde substituents suffer nucleophilic addition in the presence of organolithium compounds; however, adducts of aldehydes with lithium diamines can serve as effective directing groups for lateral lithiation. Subsequent treatment with an electrophilic primary alkyl halide and elimination of the diamine provides functionalized aryl aldehydes.
Tertiary amides are highly effective directing groups. After treatment of the resulting benzylic anion with an aldehyde, cyclization leads to lactones. Carboxamides, in which the amide is attached to the aromatic ring through nitrogen rather than carbon, are also effective directing groups.
Related O-aryl carbamates are good directing groups; upon warming, the resulting organolithiums undergo rearrangement to benzylic amides (the Snieckus-Fries rearrangement) via migration of the carbonyl carbon from oxygen to carbon.
Secondary N-aryl carbamates (along with secondary amides, ketones, and other directing groups containing acidic hydrogens) must be treated with two equivalents of organolithium reagent for lateral lithiation to occur. In the case below, sec-butyllithium is used to avoid competitive addition to the Boc group.
Sulfonamides require two equivalents of an organolithium reagent for lateral lithiation, but represent a useful class of directing groups. Treatment with ketones leads to tertiary alcohols in high yield. | 0 | Organic Chemistry |
Succinate is formed in E. coli in several steps.
Phosphoenolpyruvate (PEP), a glycolysis pathway intermediate, is carboxylated by the enzyme PEP carboxylase to form oxaloacetate.
This is followed by the conversion of oxaloacetate to malate by the enzyme malate dehydrogenase. Fumarate hydratase then catalyses the dehydration of malate to produce fumarate.
phosphoenolpyruvate + HCO → oxaloacetate + phosphate
oxaloacetate + NADH + H → malate + NAD
malate → fumarate + HO
The final reaction in the formation of succinate is the reduction of fumarate. It is catalysed by the enzyme fumarate reductase.
fumarate + NADH + H → succinate + NAD
This reduction is an anaerobic respiration reaction in E. coli, as it uses electrons associated with NADH dehydrogenase and the electron transport chain. ATP is generated by using an electrochemical gradient and ATP synthase. This is the only case in the mixed acid fermentation pathway where ATP is not produced via substrate-level phosphorylation.
Vitamin K, also known as menaquinone, is very important for electron transport to fumarate in E. coli. | 1 | Biochemistry |
* Investigation of the phenomena of stereoisometry in the series of limiting carbonaceous compounds. - Odessa: type. A. Schulze, 1891. - 190 p.
* Materials for the study of the genesis of silt deposits [Rev. ed. acad. N. D. Zelinsky]. - M.-L .: Publishing House of Acad. Sciences of the USSR, 1939. - 200 p.
* Coal as a means of combating asphyxiating and poisonous gases: An experimental study of 1915-1916. / N. D. Zelinsky and V. S. Sadikov. - M.-L .: Publishing House of Acad. Sciences of the USSR, 1941. - 131 p.
* Selected Works, vols. 1-2, M.-L., 1941;
* The great Russian chemist A. M. Butlerov (1828-1886) / Acad. N. D. Zelinsky; with the participation of M. M. Azarin. - M .: Publishing House of Moscow. islands of naturalists, 1949. - 241 p.
* Higher fatty acids and their relationship to tubercle bacilli / Acad. N. D. Zelinsky and Assoc. L. S. Bondar. - M .: Publishing House of Moscow. islands of naturalists, 1951. - 84 p.
Collection of works, vol. 1-4, M., 1954-1960 | 0 | Organic Chemistry |
* In general, if more than one alkene can be formed during dehalogenation by an elimination reaction, the more stable alkene is the major product. There are two types of elimination reactions, E1 and E2. An E2 reaction is a One step mechanism in which carbon-hydrogen and carbon-halogen bonds break to form a double bond. C=C Pi bond. An E1 reaction is the Ionization of the carbon-halogen bond breaking to give a carbocation intermediate, then the Deprotonation of the carbocation.
* For these two reactions, there are 3 possible products, 3-methyl-cyclohexene,1-methyl-cyclohexene, methylene-cyclohexane. The production of each of these occurs at different rates and the ratios of these also change over time. It is well known that the dehydration of the cis isomer is 30 times faster than the trans isomer. It then appears that the reaction proceeds mainly by a trans mechanism and, following the Zaitsev rule, 1-methylcyclohexene is preferentially formed in the early stages of the reaction. Indeed, if only about 10% of the total distillate is collected as the first fraction, one finds that the alkene is about 93% l-methylcyclohexene: at the end of the distillation one finds a value as low as 55% of l-methyl isomer.
* From these results, the phenomenon of the Evelyn effect can be observed and a conclusion can be drawn that a change of mechanism occurs somewhere during the synthesis. | 7 | Physical Chemistry |
Neuropeptidergic means "related to neuropeptides".
A neuropeptidergic agent (or drug) is a chemical which functions to directly modulate the neuropeptide systems in the body or brain. An example is opioidergics. | 1 | Biochemistry |
Microwaves impinging on matter usually interact with charges as well as with spins (via electric and magnetic field components, respectively), with the charge response typically much stronger than the spin response. But in the case of magnetic resonance, spins can be directly probed using microwaves. For paramagnetic materials, this technique is called electron spin resonance (ESR) and for ferromagnetic materials ferromagnetic resonance (FMR).
In the paramagnetic case, such an experiment probes the Zeeman splitting, with a linear relation between the static external magnetic field and the frequency of the probing microwave field. A popular combination, as implemented in commercial X-band ESR spectrometers, is approximately 0.3 T (static field) and 10 GHz (microwave frequency) for a typical material with electron g-factor close to 2. | 7 | Physical Chemistry |
If a compound has a very large specific rotation or a sample is very concentrated, the actual rotation of the sample may be larger than 180°, and so a single polarimeter measurement cannot detect when this has happened (for example, the values +270° and −90° are not distinguishable, nor are the values 361° and 1°). In these cases, measuring the rotation at several different concentrations allows one to determine the true value. Another method would be to use shorter path-lengths to perform the measurements.
In cases of very small or very large angles, one can also use the variation of specific rotation with wavelength to facilitate measurement. Switching wavelength is particularly useful when the angle is small. Many polarimeters are equipped with a mercury lamp (in addition to the sodium lamp) for this purpose. | 4 | Stereochemistry |
Eutrophication is caused by excessive concentrations of nutrients, most commonly phosphates and nitrates, although this varies with location. Prior to their being phasing out in the 1970's, phosphate-containing detergents contributed to eutrophication. Since then, sewage and agriculture have emerged as the dominant phosphate sources. The main sources of nitrogen pollution are from agricultural runoff containing fertilizers and animal wastes, from sewage, and from atmospheric deposition of nitrogen originating from combustion or animal waste.
The limitation of productivity in any aquatic system varies with the rate of supply (from external sources) and removal (flushing out) of nutrients from the body of water. This means that some nutrients are more prevalent in certain areas than others and different ecosystems and environments have different limiting factors. Phosphorus is the limiting factor for plant growth in most freshwater ecosystems, and because phosphate adheres tightly to soil particles and sinks in areas such as wetlands and lakes, due to its prevalence nowadays more and more phosphorus is accumulating inside freshwater bodies. In marine ecosystems, nitrogen is the primary limiting nutrient; nitrous oxide (created by the combustion of fossil fuels) and its deposition in the water from the atmosphere has led to an increase in nitrogen levels, and also the heightened levels of eutrophication in the ocean. | 2 | Environmental Chemistry |
Irma Goldberg (born 1871) was a Russian-born chemist. She was one of the first female organic chemists to have and sustain a successful career, her work even being quoted in her own name in standard textbooks. | 0 | Organic Chemistry |
Van der Waals forces are a subset of electrostatic interactions involving permanent or induced dipoles (or multipoles). These include the following:
* permanent dipole–dipole interactions, alternatively called the Keesom force
* dipole-induced dipole interactions, or the Debye force
* induced dipole-induced dipole interactions, commonly referred to as London dispersion forces
Hydrogen bonding and halogen bonding are typically not classified as Van der Waals forces. | 6 | Supramolecular Chemistry |
In biology, methylene blue is used as a dye for a number of different staining procedures, such as Wrights stain and Jenners stain. Since it is a temporary staining technique, methylene blue can also be used to examine RNA or DNA under the microscope or in a gel: as an example, a solution of methylene blue can be used to stain RNA on hybridization membranes in northern blotting to verify the amount of nucleic acid present. While methylene blue is not as sensitive as ethidium bromide, it is less toxic and it does not intercalate in nucleic acid chains, thus avoiding interference with nucleic acid retention on hybridization membranes or with the hybridization process itself.
It can also be used as an indicator to determine whether eukaryotic cells such as yeast are alive or dead. The methylene blue is reduced in viable cells, leaving them unstained. However dead cells are unable to reduce the oxidized methylene blue and the cells are stained blue. Methylene blue can interfere with the respiration of the yeast as it picks up hydrogen ions made during the process. | 3 | Analytical Chemistry |
Catalytic rate enhancement via dynamic perturbation of surface active sites has been demonstrated experimentally with dynamic electrocatalysis and dynamic photocatalysis. Those results may be explained in the framework of catalytic resonance theory but conclusive evidence is still lacking:
* In 1978, the electro-oxidation of formic acid on a platinum electrode was studied under the application of constant potentials and square-wave pulsed potentials. The latter was found to enhance the current density (and thus catalytic activity) by up to 20 times compared to the potentiostatic conditions, with the optimal wave amplitude and frequency of 600 mV and 2000 Hz, respectively. In 1988, the oxidation of methanol on a platinum electrode was conducted under pulsed potentials between 0.4 and 1.18 V, resulting in an average current almost 100 times higher than the steady-state current at 0.4 V.
* Using the formic acid electro-oxidation reaction, oscillation of the applied electrodynamic potential between 0 and 0.8 volts accelerated the formation rate of carbon dioxide more than an order of magnitude higher (20X) than what was achievable on platinum, the best existing catalyst. The maximum catalytic rate was experimentally observed at a frequency of 100 Hz; slower catalytic rates were observed at higher and lower electrodynamic frequencies. The resonant frequency was interpreted as the oscillation between conditions favorable to formic acid decomposition (0 V) and conditions favorable to form CO (0.8 V).
*The concept of implementing periodic illumination to improve the quantum yield of a typical photocatalytic reaction was first introduced in 1964 by Miller et al. In this work, they showed enhanced photosynthetic efficiency in the conversion of CO to O when the algal culture was exposed to periodic illumination in a Taylor vortex reactor. Sczechowski et al. later implemented the same approach for heterogeneous photocatalysis in 1993, where they demonstrated 5-fold increment in photoefficiency of formate decomposition by cycling between light and dark conditions with periods of 72 ms and 1.45 s respectively. They hypothesized that upon illumination of the catalyst, there is a critical illumination time during which absorbed photons generate oxidizing species (h) on the surface of the catalyst. The generated species or their intermediates go on to react with substrates on the surface or in the bulk. During dark period, adsorption, desorption, and diffusion generally occurs in the absence of photons. After a critical recovery period in the dark, the photocatalyst can efficiently use photons again when photons are reintroduced. A summary of work involving “dynamic” photocatalysis was provided by Tokode et al. in 2016.
* Dynamic promotion of methanol decomposition was demonstrated on 2 nm Pt nanoparticles using pulsed light. The rate acceleration to form H relative to static illumination was attributed to the selective weakening of adsorbed carbon monoxide, thereby also increasing the quantum efficiency of applied light.
*In 2021, Sordello et al. experimentally demonstrated a 50% increase of the quantum yield for the Hydrogen Evolution Reaction (HER) over Pt/TiO nanoparticles via formic acid photoreforming under Controlled Period Illumination (CPI).
Implementation of catalyst dynamics has been proposed to occur by additional methods using oscillating light, electric potential, and physical perturbation. | 7 | Physical Chemistry |
tert-Butyl hydroperoxide (tBuOOH) is the organic compound with the formula (CH)COOH. It is one of the most widely used hydroperoxides in a variety of oxidation processes, like the Halcon process. It is normally supplied as a 69–70% aqueous solution. Compared to hydrogen peroxide and organic peracids, tert-butyl hydroperoxide is less reactive and more soluble in organic solvents. Overall, it is renowned for the convenient handling properties of its solutions. Its solutions in organic solvents are highly stable. | 0 | Organic Chemistry |
In an MDS analysis, a stream of liquid containing the particles to be sized is introduced alongside an auxiliary stream in a laminar flow in a microfluidic channel. Because there is no convective mixing of the two streams, the only way particles can move to the auxiliary stream is by diffusion. The rate of this diffusion is dependent on the particle's size, as determined by the Stokes–Einstein equation, so small particles diffuse quicker than large particles.
After a period of diffusion the original and auxiliary streams are split and the degree of diffusion is fixed. The number of particles in each stream can then be detected (in the case of proteins this is achieved by addition of an amine reactive fluorogenic dye). The ratio between the two streams is used to determine the diffusion co-efficient, which is used to calculate the hydrodynamic radius. The sum of particles in both streams can also be used to measure the concentration of the analyte. | 1 | Biochemistry |
Trace amines are an endogenous group of trace amine-associated receptor 1 (TAAR1) agonists – and hence, monoaminergic neuromodulators – that are structurally and metabolically related to classical monoamine neurotransmitters. Compared to the classical monoamines, they are present in trace concentrations. They are distributed heterogeneously throughout the mammalian brain and peripheral nervous tissues and exhibit high rates of metabolism. Although they can be synthesized within parent monoamine neurotransmitter systems, there is evidence that suggests that some of them may comprise their own independent neurotransmitter systems.
Trace amines play significant roles in regulating the quantity of monoamine neurotransmitters in the synaptic cleft of monoamine neurons with . They have well-characterized presynaptic amphetamine-like effects on these monoamine neurons via TAAR1 activation; specifically, by activating TAAR1 in neurons they promote the release and prevent reuptake of monoamine neurotransmitters from the synaptic cleft as well as inhibit neuronal firing. Phenethylamine and amphetamine possess analogous pharmacodynamics in human dopamine neurons, as both compounds induce efflux from vesicular monoamine transporter 2 (VMAT2) and activate TAAR1 with comparable efficacy.
Like dopamine, norepinephrine, and serotonin, the trace amines have been implicated in a vast array of human disorders of affect and cognition, such as ADHD, depression and schizophrenia, among others. Trace aminergic hypo-function is particularly relevant to ADHD, since urinary and plasma phenethylamine concentrations are significantly lower in individuals with ADHD relative to controls and the two most commonly prescribed drugs for ADHD, amphetamine and methylphenidate, increase phenethylamine biosynthesis in treatment-responsive individuals with ADHD. A systematic review of ADHD biomarkers also indicated that urinary phenethylamine levels could be a diagnostic biomarker for ADHD. | 1 | Biochemistry |
The Schoenflies (or Schönflies) notation, named after the German mathematician Arthur Moritz Schoenflies, is a notation primarily used to specify point groups in three dimensions. Because a point group alone is completely adequate to describe the symmetry of a molecule, the notation is often sufficient and commonly used for spectroscopy. However, in crystallography, there is additional translational symmetry, and point groups are not enough to describe the full symmetry of crystals, so the full space group is usually used instead. The naming of full space groups usually follows another common convention, the Hermann–Mauguin notation, also known as the international notation.
Although Schoenflies notation without superscripts is a pure point group notation, optionally, superscripts can be added to further specify individual space groups. However, for space groups, the connection to the underlying symmetry elements is much more clear in Hermann–Mauguin notation, so the latter notation is usually preferred for space groups. | 7 | Physical Chemistry |
Water body temperature is one of the most ubiquitous variables collected in aquatic biomonitoring. Temperatures at the water surface, through the water column, and in the lowest levels of the water body (benthic zone) can all provide insight into different aspects of an aquatic ecosystem. Water temperature is directly affected by climate change and can have negative affects on many aquatic species, such as salmon. Salmon spawning is temperature dependant: there is a heat accumulation threshold which must be reached before hatching can occur. Post-hatching, salmon live in water within a critical range in temperature, with exposure to temperatures outside of this being potentially lethal. This sensitivity makes them useful indicators of changes in water temperature, hence their use in climate change studies. Similarly, Daphnia populations have been evidenced as being negatively affected by climate change, as earlier springs have caused hatching periods to de-couple from the peak window of food availability. | 2 | Environmental Chemistry |
The most abundant class of deoxyribozymes are ribonucleases, which catalyze the cleavage of a ribonucleotide phosphodiester bond through a transesterification reaction, forming a 23-cyclic phosphate terminus and a 5'-hydroxyl terminus.
Ribonuclease deoxyribozymes typically undergo selection as long, single-stranded oligonucleotides which contain a single ribonucleotide base to act as the cleavage site. Once sequenced, this single-stranded "cis"-form of the deoxyribozyme can be converted to the two-stranded "trans"-form by separating the substrate domain (containing the ribonucleotide cleavage site) and the enzyme domain (containing the catalytic core) into separate strands which can hybridize through two flanking arms consisting of complementary base pairs.
The first known deoxyribozyme was a ribonuclease, discovered in 1994 by Ronald Breaker while a postdoctoral fellow in the laboratory of Gerald Joyce at the Scripps Research Institute.
This deoxyribozyme, later named GR-5,
catalyzes the Pb-dependent cleavage of a single ribonucleotide phosphoester at a rate that is more than 100-fold compared to the uncatalyzed reaction. Subsequently, additional RNA-cleaving deoxyribozymes that incorporate different metal cofactors were developed, including the Mg-dependent E2 deoxyribozyme
and the Ca-dependent Mg5 deoxyribozyme.
These first deoxyribozymes were unable to catalyze a full RNA substrate strand, but by incorporating the full RNA substrate strand into the selection process, deoxyribozymes which functioned with substrates consisting of either full RNA or full DNA with a single RNA base were both able to be utilized.
The first of these more versatile deoxyribozymes, 8-17 and 10–23, are currently the most widely studied deoxyribozymes. In fact, many subsequently discovered deoxyribozymes were found to contain the same catalytic core motif as 8–17, including the previously discovered Mg5, suggesting that this motif represents the "simplest solution for the RNA cleavage problem".
The 10-23 DNAzyme contains a 15-nucleotide catalytic core that is flanked by two substrate recognition domains. This DNAzyme cleaves complementary RNAs efficiently in a sequence specific manner between an unpaired purine and a paired pyrimidine. DNAzymes targeting AU or GU vs. GC or AC are more effective. Furthermore, the RNA cleavage rates have been shown to increase after the introduction of intercalators or the substitution of deoxyguanine with deoxyinosine at the junction of the catalytic loop. Specifically, the addition of 2’-O-methyl modifications to the catalytic proved to significantly increase the cleavage rate both in vitro and in vivo. Additionally, recent studies have focuses on unravelling their kinetics to further understand their performance.
Other notable deoxyribozyme ribonucleases are those that are highly selective for a certain cofactor. Among this group are the metal selective deoxyribozymes such as Pb-specific 17E,
UO-specific 39E,
and Na-specific A43. First crystal structure of a DNAzyme was reported in 2016. 10-23 core based DNAzymes and the respective MNAzymes that catalyse reactions at ambient temperatures were described in 2018 and open doors for use of these nucleic acid based enzymes for many other applications without the need for heating.
A DNA molecule with sequence 5-GGAGAACGCGAGGCAAGGCTGGGAGAAATGTGGATCACGATT-3 acts as a deoxyribozyme that uses light to repair a thymine dimer, using serotonin as cofactor. | 7 | Physical Chemistry |
To answer this question one should know the different and important functions of glycans. The following are some of those functions:
*Glycoproteins and Glycolipids found on the cell surface play a critical role in bacterial and viral recognition.
*They are involved in cellular signaling pathways and modulate cell function.
*They are important in innate immunity.
*They determine cancer development.
*They orchestrate the cellular fate, inhibit proliferation, regulate circulation and invasion.
*They affect the stability and folding of proteins.
*They affect the pathway and fate of glycoproteins.
*There are many glycan-specific diseases, often hereditary diseases.
There are important medical applications of aspects of glycomics:
*Lectins fractionate cells to avoid graft-versus-host disease in hematopoietic stem cell transplantation.
*Activation and expansion of cytolytic CD8 T cells in cancer treatment.
Glycomics is particularly important in microbiology because glycans play diverse roles in bacterial physiology. Research in bacterial glycomics could lead to the development of:
* novel drugs
* bioactive glycans
* glycoconjugate vaccines | 0 | Organic Chemistry |
*Johnson, D. W., Johnson, R. T., & Smith, K. A. (1998). Cooperative learning returns to college what evidence is there that it works?. Change: the magazine of higher learning, 30(4), 26–35.
*Smith, K.A. (2000). Going deeper: Formal small-group learning in large classes. In MacGregor, J., Cooper, J., Smith, K, and Robinson, P., eds. Strategies for Energizing Large Classes: From Small Groups to Learning Communities. New Directions for Teaching and Learning, 81, 25–46. San Francisco: Jossey-Bass.
*Johnson, D.W., Johnson, R.T., and Smith, K.A. (2000). Constructive controversy: The power of intellectual conflict. Change, 32 (1), 28–37.
*Wankat, P. C., Felder, R. M., Smith, K. A., & Oreovicz, F. S. (2002). The scholarship of teaching and learning in engineering. In M.T. Huber & S.P. Morreale, eds., Disciplinary styles in the scholarship of teaching and learning, 217–237.
*Smith, K. A., Sheppard, S. D., Johnson, D. W., & Johnson, R. T. (2005). Pedagogies of engagement: Classroom‐based practices. Journal of Engineering Education, 94(1), 87–101.
*Johnson, D. W., Johnson, R. T., & Smith, K. (2007). The state of cooperative learning in postsecondary and professional settings. Educational psychology review, 19, 15–29.
*Froyd, J. E., Wankat, P. C., & Smith, K. A. (2012). Five major shifts in 100 years of engineering education. Proceedings of the IEEE, 100(Special Centennial Issue), 1344–1360.
*Singer, S. & Smith, K.A. (2013). Discipline-Based Education Research: Understanding and Improving Learning in Undergraduate Science and Engineering. Guest Editorial. Journal of Engineering Education, 102, 468–471.
*Lichtenstein, G., Chen, H.L., Smith, K.A. & Maldonado, T.A. (2013). Retention and Persistence of Women and Minorities Along the Engineering Pathway in the United States. In A. Johri & B. Olds (Eds), Cambridge Handbook on Engineering Education Research.
*Johnson, D. W., Johnson, R. T., & Smith, K. A. (2014). Cooperative learning: Improving university instruction by basing practice on validated theory. Journal on Excellence in University Teaching, 25(4), 1-26.
*Streveler, R.A. & Smith, K.A. (2020). Opinion: Course Design in the Time of Coronavirus: Put on your Designer's CAP. Advances in Engineering Education, COVID-19 Issue.
*Smith, K.A. & Starfield, A.M. (2023). Reflections on modeling and teaching modeling. The Journal of Undergraduate Mathematics and Its Applications (UMAP), 44(2).
*Smith, K.A. & Felder, R.M. (2023). Cooperative Learning in Engineering Education: The Story of an Ongoing Uphill Climb. In Robyn Gillies, Barbara Millis, and Neil Davidson, eds. Contemporary Global Perspectives on Cooperative Learning. New York: Routledge. | 8 | Metallurgy |
Several azo dyes like Metanil Yellow, Disperse Orange 1, and Acid orange 5 are derivatives of diphenylamine. | 3 | Analytical Chemistry |
A mixture of copper and iron sulfides referred to as matte is treated in converters to oxidize iron in the first stage, and oxidize copper in the second stage. In the first stage oxygen enriched air is blown through the tuyeres to partially convert metal sulfides to oxides:
:FeS + O → FeO + SO
:CuS + O → CuO + SO
Since iron has greater affinity to oxygen, the produced copper oxide reacts with the remaining iron sulfide:
:CuO + FeS → CuS + FeO
The bulk of the copper oxide is turned back into the form of sulfide. In order to separate the obtained iron oxide, flux (mainly silica) is added into the converter. Silica reacts with iron oxide to produce a light slag phase, which is poured off through the hood when the converter is tilted around the rotation axis:
:2 FeO + SiO → FeSiO (sometimes denoted as 2FeO•SiO, fayalite)
After the first portion of slag is poured off the converter, a new portion of matte is added, and the converting operation is repeated many times until the converter is filled with the purified copper sulfide. The converter slag is usually recycled to the smelting stage due to the high content of copper in this by-product. Converter gas contains more than 10% of sulfur dioxide, which is usually captured for the production of sulfuric acid.
The second stage of converting is aimed at oxidizing the copper sulfide phase (purified in the first stage), and produces blister copper. The following reaction takes place in the converter:
:CuS + O → Cu + SO
Copper content in the obtained blister copper is typically more than 95%. Blister copper is the final product of converting. | 8 | Metallurgy |
In materials science, critical resolved shear stress (CRSS) is the component of shear stress, resolved in the direction of slip, necessary to initiate slip in a grain. Resolved shear stress (RSS) is the shear component of an applied tensile or compressive stress resolved along a slip plane that is other than perpendicular or parallel to the stress axis. The RSS is related to the applied stress by a geometrical factor, , typically the Schmid factor:
where is the magnitude of the applied tensile stress, is the angle between the normal of the slip plane and the direction of the applied force, and is the angle between the slip direction and the direction of the applied force. The Schmid factor is most applicable to FCC single-crystal metals, but for polycrystal metals the Taylor factor has been shown to be more accurate. The CRSS is the value of resolved shear stress at which yielding of the grain occurs, marking the onset of plastic deformation. CRSS, therefore, is a material property and is not dependent on the applied load or grain orientation. The CRSS is related to the observed yield strength of the material by the maximum value of the Schmid factor:
CRSS is a constant for crystal families. Hexagonal close-packed crystals, for example, have three main families - basal, prismatic, and pyramidal - with different values for the critical resolved shear stress. | 8 | Metallurgy |
Dendrimers are particularly versatile drug delivery devices due to the wide range of chemical modifications that can be made to increase in vivo suitability and allow for site-specific targeted drug delivery.
Drug attachment to the dendrimer may be accomplished by (1) a covalent attachment or conjugation to the external surface of the dendrimer forming a dendrimer prodrug, (2) ionic coordination to charged outer functional groups, or (3) micelle-like encapsulation of a drug via a dendrimer-drug supramolecular assembly. In the case of a dendrimer prodrug structure, linking of a drug to a dendrimer may be direct or linker-mediated depending on desired release kinetics. Such a linker may be pH-sensitive, enzyme catalyzed, or a disulfide bridge. The wide range of terminal functional groups available for dendrimers allows for many different types of linker chemistries, providing yet another tunable component on the system. Key parameters to consider for linker chemistry are (1) release mechanism upon arrival to the target site, whether that be within the cell or in a certain organ system, (2) drug-dendrimer spacing so as to prevent lipophilic drugs from folding into the dendrimer, and (3) linker degradability and post-release trace modifications on drugs.
Polyethylene glycol (PEG) is a common modification for dendrimers to modify their surface charge and circulation time. Surface charge can influence the interactions of dendrimers with biological systems, such as amine-terminal modified dendrimers which have a propensity to interact with cell membranes with anionic charge. Certain in vivo studies have shown polycationic dendrimers to be cytotoxic through membrane permeabilization, a phenomenon that could be partially mitigated via addition of PEGylation caps on amine groups, resulting in lower cytotoxicity and lower red blood cell hemolysis. Additionally, studies have found that PEGylation of dendrimers results in higher drug loading, slower drug release, longer circulation times in vivo, and lower toxicity in comparison to counterparts without PEG modifications.
Numerous targeting moieties have been used to modify dendrimer biodistribution and allow for targeting to specific organs. For example, folate receptors are overexpressed in tumor cells and are therefore promising targets for localized drug delivery of chemotherapeutics. Folic acid conjugation to PAMAM dendrimers has been shown to increase targeting and decrease off-target toxicity while maintaining on-target cytotoxicity of chemotherapeutics such as methotrexate, in mouse models of cancer.
Antibody-mediated targeting of dendrimers to cell targets has also shown promise for targeted drug delivery. As epidermal growth factor receptors (EGFRs) are often overexpressed in brain tumors, EGFRs are a convenient target for site-specific drug delivery. The delivery of boron to cancerous cells is important for effective neutron capture therapy, a cancer treatment which requires a large concentration of boron in cancerous cells and a low concentration in healthy cells. A boronated dendrimer conjugated with a monoclonal antibody drug that targets EGFRs was used in rats to successfully deliver boron to cancerous cells.
Modifying nanoparticle dendrimers with peptides has also been successful for targeted destruction of colorectal (HCT-116) cancer cells in a co-culture scenario. Targeting peptides can be used to achieve site- or cell-specific delivery, and it has been shown that these peptides increase in targeting specificity when paired with dendrimers. Specifically, gemcitabine-loaded YIGSR-CMCht/PAMAM, a unique kind of dendrimer nanoparticle, induces a targeted mortality on these cancer cells. This is performed via selective interaction of the dendrimer with laminin receptors. Peptide dendrimers may be employed in the future to precisely target cancer cells and deliver chemotherapeutic agents.
The cellular uptake mechanism of dendrimers can also be tuned using chemical targeting modifications. Non-modified PAMAM-G4 dendrimer is taken up into activated microglia by fluid phase endocytosis. Conversely, mannose modification of hydroxyl PAMAM-G4 dendrimers was able to change the mechanism of internalization to mannose-receptor (CD206) mediated endocytosis. Additionally, mannose modification was able to change the biodistribution in the rest of the body in rabbits. | 6 | Supramolecular Chemistry |
Naturally occurring restriction endonucleases are categorized into five groups (Types I, II, III, IV, and V) based on their composition and enzyme cofactor requirements, the nature of their target sequence, and the position of their DNA cleavage site relative to the target sequence. DNA sequence analysis of restriction enzymes however show great variations, indicating that there are more than four types. All types of enzymes recognize specific short DNA sequences and carry out the endonucleolytic cleavage of DNA to give specific fragments with terminal 5'-phosphates. They differ in their recognition sequence, subunit composition, cleavage position, and cofactor requirements, as summarised below:
* Type I enzymes () cleave at sites remote from a recognition site; require both ATP and S-adenosyl-L-methionine to function; multifunctional protein with both restriction digestion and methylase () activities.
* Type II enzymes () cleave within or at short specific distances from a recognition site; most require magnesium; single function (restriction digestion) enzymes independent of methylase.
* Type III enzymes () cleave at sites a short distance from a recognition site; require ATP (but do not hydrolyse it); S-adenosyl-L-methionine stimulates the reaction but is not required; exist as part of a complex with a modification methylase ().
* Type IV enzymes target modified DNA, e.g. methylated, hydroxymethylated and glucosyl-hydroxymethylated DNA
* Type V enzymes utilize guide RNAs (gRNAs) | 1 | Biochemistry |
The equations in the previous subsection reveal that the , , and terms originate through three distinct mechanisms.
The term arises from Zeeman splitting of the ground or excited degenerate states. These field-dependent changes in energies of the magnetic sublevels causes small shifts in the bands to higher/lower energy. The slight offsets result in incomplete cancellation of the positive and negative features, giving a net derivative shape in the spectrum. This intensity mechanism is generally independent of sample temperature.
The term is due to the field-induced mixing of states. Energetic proximity of a third state to either the ground state or excited state gives appreciable Zeeman coupling in the presence of an applied external field. As the strength of the magnetic field increases, the amount of mixing increases to give growth of an absorption band shape. Like the term, the term is generally temperature independent. Temperature dependence of term intensity can sometimes be observed when is particularly low-lying in energy.
The term requires the degeneracy of the ground state, often encountered for paramagnetic samples. This happens due to a change in the Boltzmann population of the magnetic sublevels, which is dependent on the degree of field-induced splitting of the sublevel energies and on the sample temperature. Decrease of the temperature and increase of the magnetic field increases the term intensity until it reaches the maximum (saturation limit). Experimentally, the term spectrum can be obtained from MCD raw data by subtraction of MCD spectra measured in the same applied magnetic field at different temperatures, while and terms can be distinguished via their different band shapes.
The relative contributions of A, B and C terms to the MCD spectrum are proportional to the inverse line width, energy splitting, and temperature:
where is line width and is the zero-field state separation. For typical values of = 1000 cm, = 10,000 cm and = 6 cm (at 10 K), the three terms make relative contributions 1:0.1:150. So, at low temperature the term dominates over and for paramagnetic samples. | 7 | Physical Chemistry |
Chiral analysis refers to the quantification of component enantiomers of racemic drug substances or pharmaceutical compounds. Other synonyms commonly used include enantiomer analysis, enantiomeric analysis, and enantioselective analysis. Chiral analysis includes all analytical procedures focused on the characterization of the properties of chiral drugs. Chiral analysis is usually performed with chiral separation methods where the enantiomers are separated on an analytical scale and simultaneously assayed for each enantiomer.
Many compounds of biological and pharmacological interest are chiral. Pharmacodynamic, pharmacokinetic, and toxicological properties of the enantiomers of racemic chiral drugs has expanded significantly and become a key issue for both the pharmaceutical industry and regulatory agencies. Typically one of the enantiomers is more active pharmacologically (eutomer). In several cases, unwanted side effects or even toxic effects may occur with the inactive enantiomer (distomer). Even if the side effects are not that serious, the inactive enantiomer has to be metabolized, this puts an unnecessary burden on the already stressed out system of the patient. Large differences in activity between enantiomers reveal the need to accurate assessment of enantiomeric purity of pharmaceutical, agrochemicals, and other chemical entities like fragrances and flavors become very important. Moreover, the moment a racemic therapeutic is placed in a biological system, a chiral environment, it is no more 50:50 due enantioselective absorption, distribution, metabolism, and elimination (ADME) process. Hence to track the individual enantiomeric profile there is a need for chiral analysis tool.
Chiral technology is an active subject matter related to asymmetric synthesis and enantioselective analysis, particularly in the area of chiral chromatography. As a consequence of the advances in chiral technology, a number of pharmaceuticals currently marketed as racemic drugs are undergoing re-assessment as chiral specific products or chiral switches. Despite the choice to foster either a single enantiomer or racemic drug, in the current regulatory environment, there will be a need for enantioselective investigations. This poses a big challenge to pharmaceutical analysts and chromatographers involved in drug development process. In pharmaceutical research and development stereochemical analytical methodology may be required to comprehend enantioselective drug action and disposition, chiral purity assessment, study stereochemical stability during formulation and production, assess dosage forms, enantiospecific bioavailability and bioequivalence investigations of chiral drugs. Besides pharmaceutical applications chiral analysis plays a major role in the study of biological and environmental samples and also in the forensic field. Chiral analysis methods and applications between the period 2010 and 2020 are exhaustively reviewed recently. There are number of articles, columns, and interviews in [https://www.chromatographyonline.com/ LCGC] relating to emerging trends in chiral analysis and its application in drug discovery and development process.
For chiral examination there is a need to have the right chiral environment. This could be provided as a plane polarized light, an additional chiral compound or by exploiting the inborn chirality of nature. The chiral analytical strategies incorporate physical, biological, and separation science techniques. Recently an optical-based absolute chiral analysis has been reported. The most frequently employed technique in enantioselective analysis involve the separation science techniques, in particular chiral chromatographic methods or chiral chromatography. Today wide range of CSPs are available commercially based on various chiral selectors including polysaccharides, cyclodextrins, glycopeptide antibiotics, proteins, Pirkle, crown ethers, etc. to achieve analysis of chiral molecules. | 4 | Stereochemistry |
In biotechnology, polymersomes are a class of artificial vesicles, tiny hollow spheres that enclose a solution. Polymersomes are made using amphiphilic synthetic block copolymers to form the vesicle membrane, and have radii ranging from 50 nm to 5 µm or more. Most reported polymersomes contain an aqueous solution in their core and are useful for encapsulating and protecting sensitive molecules, such as drugs, enzymes, other proteins and peptides, and DNA and RNA fragments. The polymersome membrane provides a physical barrier that isolates the encapsulated material from external materials, such as those found in biological systems.
Synthosomes are polymersomes engineered to contain channels (transmembrane proteins) that allow certain chemicals to pass through the membrane, into or out of the vesicle. This allows for the collection or enzymatic modification of these substances.
The term "polymersome" for vesicles made from block copolymers was coined in 1999. Polymersomes are similar to liposomes, which are vesicles formed from naturally occurring lipids. While having many of the properties of natural liposomes, polymersomes exhibit increased stability and reduced permeability. Furthermore, the use of synthetic polymers enables designers to manipulate the characteristics of the membrane and thus control permeability, release rates, stability and other properties of the polymersome. | 1 | Biochemistry |
*CJ Ferguson, RJ Hughes, BTT Pham, BS Hawkett, RG Gilbert, AK Serelis, CH Such. Aqueous dispersions of polymer particles. PCT/AU02/01735 (2002)
*S Peach, BR Morrison, RG Gilbert. Finely divided polymer dispersions, their production and use. Ger. Offen. DE 19929395 (2000)
*N Subramaniam, R Balic, RG Gilbert. Modified rubber polymer latex. PCT/AU98/00191 (1998)
*D Kukulj, TP Davis, RG Gilbert. Polymerization reactions under miniemulsion conditions. PCT PN6696 (1997) | 0 | Organic Chemistry |
As a strong base, TBD fully deprotonates most phenols, carboxylic acids, and some C-acids. It catalyzes a variety of reactions including Michael reactions, Henry reactions (nitroaldol reactions), transesterification reactions, and Knoevenagel condensations.
Deprotonation at the 7-position gives a particularly electron-rich ligand as manifested in the redox properties of ditungsten tetra(hpp). | 0 | Organic Chemistry |
Although the Interferometric microscopy has been demonstrated only for optical images (visible light), this technique may find application in high resolution atom optics, or optics of neutral atom beams (see Atomic de Broglie microscope), where the Numerical aperture is usually very limited | 7 | Physical Chemistry |
SERS-based immunoassays can be used for detection of low-abundance biomarkers. For example, antibodies and gold particles can be used to quantify proteins in serum with high sensitivity and specificity. | 7 | Physical Chemistry |
The lac repressor (LacI) is a DNA-binding protein that inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. These genes are repressed when lactose is not available to the cell, ensuring that the bacterium only invests energy in the production of machinery necessary for uptake and utilization of lactose when lactose is present. When lactose becomes available, it is firstly converted into allolactose by β-Galactosidase (lacZ) in bacteria. The DNA binding ability of lac repressor bound with allolactose is inhibited due to allosteric regulation, thereby genes coding for proteins involved in lactose uptake and utilization can be expressed. | 1 | Biochemistry |
E. coli has a protein to protect other periplasmic proteins from low pH environments called the Asr protein. The gene responsible for this protein is PhoB-dependent, and can only be turned on when the Pho regulon is activated by low Pi concentration. Synthesis of the Asr protein imparts acid shock resistance to E. coli enabling it to survive in environments like the stomach which has a low pH. Many acid tolerance genes are induced by more than just the low pH environment and require other environmental signals to be present in order to be activated. These specific nutrients being present or in low concentrations, anaerobiosis, and host-produced factors. | 1 | Biochemistry |
Usually the endosymbiosis event is considered to have occurred in the Archaeplastida, within which the glaucophyta being the possible earliest diverging lineage. The glaucophyte chloroplast group is the smallest of the three primary chloroplast lineages, being found in only 13 species, and is thought to be the one that branched off the earliest. Glaucophytes have chloroplasts that retain a peptidoglycan wall between their double membranes, like their cyanobacterial parent. For this reason, glaucophyte chloroplasts are also known as muroplasts (besides cyanoplasts or cyanelles). Glaucophyte chloroplasts also contain concentric unstacked thylakoids, which surround a carboxysome – an icosahedral structure that glaucophyte chloroplasts and cyanobacteria keep their carbon fixation enzyme RuBisCO in. The starch that they synthesize collects outside the chloroplast. Like cyanobacteria, glaucophyte and rhodophyte chloroplast thylakoids are studded with light collecting structures called phycobilisomes. For these reasons, glaucophyte chloroplasts are considered a primitive intermediate between cyanobacteria and the more evolved chloroplasts in red algae and plants. | 5 | Photochemistry |
Fuzzy regions modulate the conformational equilibrium or flexibility of the binding interface via transient interactions. Dynamic regions can also compete with binding sites or tether them to the target. Modifications of fuzzy regions by further interactions, or posttranslational modifications impact binding affinity or specificity. Alternative splicing can modulate the length of fuzzy regions resulting in context-dependent binding (e.g. tissue-specificity) on the complex. EGF/MAPK, TGF-β and WNT/Wingless signaling pathways employ tissue-specific fuzzy regions. | 4 | Stereochemistry |
Powder metallurgy is a class of modern processing techniques in which metals are first powdered, and then formed into the desired shape by heating below the melting point. This is in contrast to casting, which occurs with molten metal. Superalloy manufacturing often employs powder metallurgy because of its material efficiency - typically much less waste metal must be machined away from the final product—and its ability to facilitate mechanical alloying. Mechanical alloying is a process by which reinforcing particles are incorporated into the superalloy matrix material by repeated fracture and welding. | 8 | Metallurgy |
Mathematically, the stress at some point in the material is a plane stress if one of the three principal stresses (the eigenvalues of the Cauchy stress tensor) is zero. That is, there is Cartesian coordinate system in which the stress tensor has the form
For example, consider a rectangular block of material measuring 10, 40 and 5 cm along the , , and , that is being stretched in the direction and compressed in the direction, by pairs of opposite forces with magnitudes 10 N and 20 N, respectively, uniformly distributed over the corresponding faces. The stress tensor inside the block will be
More generally, if one chooses the first two coordinate axes arbitrarily but perpendicular to the direction of zero stress, the stress tensor will have the form
and can therefore be represented by a 2 × 2 matrix, | 8 | Metallurgy |
In chemistry, materials science, and physics, the liquidus temperature specifies the temperature above which a material is completely liquid, and the maximum temperature at which crystals can co-exist with the melt in thermodynamic equilibrium. The solidus is the locus of temperatures (a curve on a phase diagram) below which a given substance is completely solid (crystallized). The solidus temperature, specifies the temperature below which a material is completely solid, and the minimum temperature at which a melt can co-exist with crystals in thermodynamic equilibrium.
Liquidus and solidus are mostly used for impure substances (mixtures) such as glasses, metal alloys, ceramics, rocks, and minerals. Lines of liquidus and solidus appear in the phase diagrams of binary solid solutions, as well as in eutectic systems away from the invariant point. | 7 | Physical Chemistry |
The biological pump (or ocean carbon biological pump or marine biological carbon pump) is the ocean's biologically driven sequestration of carbon from the atmosphere and land runoff to the ocean interior and seafloor sediments. In other words, it is a biologically mediated process which results in the sequestering of carbon in the deep ocean away from the atmosphere and the land. The biological pump is the biological component of the "marine carbon pump" which contains both a physical and biological component. It is the part of the broader oceanic carbon cycle responsible for the cycling of organic matter formed mainly by phytoplankton during photosynthesis (soft-tissue pump), as well as the cycling of calcium carbonate (CaCO) formed into shells by certain organisms such as plankton and mollusks (carbonate pump).
Budget calculations of the biological carbon pump are based on the ratio between sedimentation (carbon export to the ocean floor) and remineralization (release of carbon to the atmosphere).
The biological pump is not so much the result of a single process, but rather the sum of a number of processes each of which can influence biological pumping. Overall, the pump transfers about 10.2 gigatonnes of carbon every year into the ocean's interior and a total of 1300 gigatonnes carbon over an average 127 years. This takes carbon out of contact with the atmosphere for several thousand years or longer. An ocean without a biological pump would result in atmospheric carbon dioxide levels about 400 ppm higher than the present day. | 9 | Geochemistry |
In theoretical physics, the Mandelstam variables are numerical quantities that encode the energy, momentum, and angles of particles in a scattering process in a Lorentz-invariant fashion. They are used for scattering processes of two particles to two particles. The Mandelstam variables were first introduced by physicist Stanley Mandelstam in 1958.
If the Minkowski metric is chosen to be , the Mandelstam variables are then defined by
where p and p are the four-momenta of the incoming particles and p and p are the four-momenta of the outgoing particles.
is also known as the square of the center-of-mass energy (invariant mass) and as the square of the four-momentum transfer. | 7 | Physical Chemistry |
Flutamide and hydroxyflutamide have been found in vitro to inhibit CYP17A1 (17α-hydroxylase/17,20-lyase), an enzyme which is required for the biosynthesis of androgens. In accordance, flutamide has been found to slightly but significantly lower androgen levels in GnRH analogue-treated male prostate cancer patients and women with polycystic ovary syndrome. In a directly comparative study of flutamide monotherapy (375mg once daily) versus bicalutamide monotherapy (80mg once daily) in Japanese men with prostate cancer, after 24weeks of treatment flutamide decreased dehydroepiandrosterone (DHEA) levels by about 44% while bicalutamide increased them by about 4%. As such, flutamide is a weak inhibitor of androgen biosynthesis. However, the clinical significance of this action may be limited when flutamide is given without a GnRH analogue to non-castrated men, as the medication markedly elevates testosterone levels into the high normal male range via prevention of AR activation-mediated negative feedback on the hypothalamic–pituitary–gonadal axis in this context. | 4 | Stereochemistry |
Although other cells lines, such as African green monkey kidney (COS) and baby hamster kidney (BHK), can be used for recombinant protein production, the most commonly employed host system in transient expression of mammalian cells involves derivatives of the HEK293 cell line, which is based on the human embryonic kidney cell line established in 1977 by Graham et al. The HEK293 cell line was created via transformation with sheared Adenovirus 5 DNA. Advantages of using this cell line include their high rates of transfection and ability to grow in a serum-free medium, which results in reduced cost and lowered risk of contamination with animal-derived material typically found in serum.
Several engineered sublines were later developed by incorporating viral elements derived from mammalian viruses, such as SV40 virus or Epstein–Barr virus (EBV), which are notable for their high retention of plasmid DNA in an episomal state and their capacity to increase transcription and translation via specific viral properties. These later sublines were consequently identified to have two interacting components: the SV40 large T-antigen binding to the SV20 origin of replication (SV40ori) and the EBV-derived nuclear antigen-1 (EBNA-1) protein to its associated origin of replication (oriP).
Typical historical yields of transient expression in HEK293 cells transfected using PEI-25kDa was 20-40 mg/L of recombinant antibody protein. In 2008, Backliwal et. al reported for the first time yields crossing 1 g/L of recombinant antibody protein. | 1 | Biochemistry |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.